![]() |
miRBase |
![]() |
![]() |
Stem-loop sequence sme-bantam-b |
|||||
Accession | MI0005120 (change log) | ||||
Description | Schmidtea mediterranea bantam-b stem-loop | ||||
Gene family | MIPF0000153; bantam | ||||
Literature search |
2 open access papers mention sme-bantam-b | ||||
Stem-loop |
-------- aaaac u a au 5' cuuua cgguuuucgu g gaucuuagau a ||||| |||||||||| | |||||||||| 3' gaagu gucgaaagcg c cuagagucua u cuuucgcu -auua u a cu |
||||
Confidence |
Annotation confidence: not enough data
| ||||
Genome context |
|
||||
Database links |
|
Mature sequence sme-bantam-b-5p |
|
Accession | MIMAT0012085 |
Previous IDs | sme-bantam-b* |
Sequence |
10 - ccgguuuucguugagaucuua - 30 |
Evidence | experimental; 454 [2], Illumina [2-3] |
Mature sequence sme-bantam-b-3p |
|
Accession | MIMAT0003950 |
Previous IDs | sme-bantam-b |
Sequence |
43 - ugagaucacugcgaaagcugau - 64 |
Evidence | experimental; cloned [1], Northern [1], Illumina [2] |
References |
|
1 |
PMID:16849698
"MicroRNAs from the Planarian Schmidtea mediterranea: a model system for stem cell biology"
RNA. 12:1640-1649(2006).
|
2 |
PMID:19564616
"High-resolution profiling and discovery of planarian small RNAs"
Proc Natl Acad Sci U S A. 106:11546-11551(2009).
|
3 |
PMID:19553344
"Deep sequencing identifies new and regulated microRNAs in Schmidtea mediterranea"
RNA. 15:1483-1491(2009).
|