Stem-loop sequence sme-let-7b

AccessionMI0005123 (change log)
DescriptionSchmidtea mediterranea let-7b stem-loop
Literature search

2 open access papers mention sme-let-7b
(9 sentences)

Stem-loop
       ca       uu    -     u        a   aa 
5' guaa  uuaacaa  gagg uagau guuggaug cuu  u
   ||||  |||||||  |||| ||||| |||||||| |||  u
3' cauu  aauuguu  cuuc gucua caacuuac gaa  u
       -a       cu    u     u        c   au 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (WUSTL3.1) Overlapping transcripts
Contig20276: 1039-1119 [+]
intergenic
Contig3897: 40577-40657 [-]
intergenic
Clustered miRNAs
< 10kb from sme-let-7b
sme-mir-36bContig20276: 572-672 [+]
sme-let-7bContig20276: 1039-1119 [+]
Database links

Mature sequence sme-let-7b-5p

Accession MIMAT0003953
Previous IDssme-let-7b
Sequence

15 - 

ugagguagauuguuggaugacu

 - 36

Get sequence
Evidence experimental; cloned [1], Northern [1], 454 [2], Illumina [2]

Mature sequence sme-let-7b-3p

Accession MIMAT0003954
Previous IDssme-let-7b*
Sequence

48 - 

ccauucaacuaucugucuucuc

 - 69

Get sequence
Evidence experimental; cloned [1], 454 [2], Illumina [2-3]

References

1
PMID:16849698 "MicroRNAs from the Planarian Schmidtea mediterranea: a model system for stem cell biology" Palakodeti D, Smielewska M, Graveley BR RNA. 12:1640-1649(2006).
2
PMID:19564616 "High-resolution profiling and discovery of planarian small RNAs" Friedlander MR, Adamidi C, Han T, Lebedeva S, Isenbarger TA, Hirst M, Marra M, Nusbaum C, Lee WL, Jenkin JC, Sanchez Alvarado A, Kim JK, Rajewsky N Proc Natl Acad Sci U S A. 106:11546-11551(2009).
3
PMID:19553344 "Deep sequencing identifies new and regulated microRNAs in Schmidtea mediterranea" Lu YC, Smielewska M, Palakodeti D, Lovci MT, Aigner S, Yeo GW, Graveley BR RNA. 15:1483-1491(2009).