Stem-loop sequence sme-let-7b

Accession

MI0005123 (change log)

Description

Schmidtea mediterranea let-7b stem-loop

Literature search

2 open access papers mention sme-let-7b
(9 sentences)

Stem-loop

       ca       uu    -     u        a   aa 
5' guaa  uuaacaa  gagg uagau guuggaug cuu  u
   ||||  |||||||  |||| ||||| |||||||| |||  u
3' cauu  aauuguu  cuuc gucua caacuuac gaa  u
       -a       cu    u     u        c   au 

Confidence

Annotation confidence: not enough data

Feedback: Do you believe this miRNA is real?

Genome context

Coordinates (WUSTL3.1)	Overlapping transcripts
Contig20276: 1039-1119 [+]	intergenic
Contig3897: 40577-40657 [-]	intergenic

Clustered miRNAs

< 10kb from sme-let-7b

• sme-mir-36b: Contig20276: 572-672 [+]
• sme-let-7b: Contig20276: 1039-1119 [+]

Database links

• miRBase Tracker:MI0005123

Mature sequence sme-let-7b-5p

• Accession: MIMAT0003953
• Previous IDs: sme-let-7b
• Sequence: 15 - ugagguagauuguuggaugacu - 36
• Evidence: experimental; cloned [1], Northern [1], 454 [2], Illumina [2]

Mature sequence sme-let-7b-3p

• Accession: MIMAT0003954
• Previous IDs: sme-let-7b*
• Sequence: 48 - ccauucaacuaucugucuucuc - 69
• Evidence: experimental; cloned [1], 454 [2], Illumina [2-3]

References

1. PMID:16849698 "MicroRNAs from the Planarian Schmidtea mediterranea: a model system for stem cell biology" Palakodeti D, Smielewska M, Graveley BR RNA. 12:1640-1649(2006).
2. PMID:19564616 "High-resolution profiling and discovery of planarian small RNAs" Friedlander MR, Adamidi C, Han T, Lebedeva S, Isenbarger TA, Hirst M, Marra M, Nusbaum C, Lee WL, Jenkin JC, Sanchez Alvarado A, Kim JK, Rajewsky N Proc Natl Acad Sci U S A. 106:11546-11551(2009).
3. PMID:19553344 "Deep sequencing identifies new and regulated microRNAs in Schmidtea mediterranea" Lu YC, Smielewska M, Palakodeti D, Lovci MT, Aigner S, Yeo GW, Graveley BR RNA. 15:1483-1491(2009).