Stem-loop sequence sme-let-7c

AccessionMI0005124 (change log)
DescriptionSchmidtea mediterranea let-7c stem-loop
Literature search

2 open access papers mention sme-let-7c
(9 sentences)

Stem-loop
        c     a        -  u  cu         gaagaaa   au a 
5' ucaua uaacu gaugaggu ag ga  caaaagguu       uac  c a
   ||||| ||||| |||||||| || ||  |||||||||       |||  |  
3' aguau auuga cuauuucg uc cu  guuuuccaa       aug  g a
        -     -        a  u  uu         ------a   ag u 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (WUSTL3.1) Overlapping transcripts
Contig10988: 10654-10748 [-]
intergenic
Database links

Mature sequence sme-let-7c-5p

Accession MIMAT0003955
Previous IDssme-let-7c
Sequence

15 - 

ugagguagugacucaaaagguu

 - 36

Get sequence
Evidence experimental; cloned [1], 454 [2], Illumina [2-3]

Mature sequence sme-let-7c-3p

Accession MIMAT0012088
Previous IDssme-let-7c*
Sequence

62 - 

accuuuuguuucucuagcuuuau

 - 84

Get sequence
Evidence experimental; Illumina [2-3]

References

1
PMID:16849698 "MicroRNAs from the Planarian Schmidtea mediterranea: a model system for stem cell biology" Palakodeti D, Smielewska M, Graveley BR RNA. 12:1640-1649(2006).
2
PMID:19564616 "High-resolution profiling and discovery of planarian small RNAs" Friedlander MR, Adamidi C, Han T, Lebedeva S, Isenbarger TA, Hirst M, Marra M, Nusbaum C, Lee WL, Jenkin JC, Sanchez Alvarado A, Kim JK, Rajewsky N Proc Natl Acad Sci U S A. 106:11546-11551(2009).
3
PMID:19553344 "Deep sequencing identifies new and regulated microRNAs in Schmidtea mediterranea" Lu YC, Smielewska M, Palakodeti D, Lovci MT, Aigner S, Yeo GW, Graveley BR RNA. 15:1483-1491(2009).