Stem-loop sequence sme-lin-4

AccessionMI0005125 (change log)
DescriptionSchmidtea mediterranea lin-4 stem-loop
Stem-loop
      a     aaucu     a  c u          uugaccauuaaauu    g 
5' auc guuau     cccug ga c ucgacugugu              auca a
   ||| |||||     ||||| || | ||||||||||              ||||  
3' uag cgaua     gggau cu g agcugacacg              uagu a
      c     aaauu     a  a u          -------------u    a 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (WUSTL3.1) Overlapping transcripts
Contig1776: 50558-50654 [-]
intergenic
Database links

Mature sequence sme-lin-4-5p

Accession MIMAT0003956
Previous IDssme-lin-4
Sequence

14 - 

ucccugagaccuucgacugugu

 - 35

Get sequence
Evidence experimental; cloned [1], Northern [1], 454 [2], Illumina [2]

Mature sequence sme-lin-4-3p

Accession MIMAT0012089
Sequence

64 - 

cacagucgaugaucauaggguu

 - 85

Get sequence
Evidence experimental; 454 [2], Illumina [2-3]

References

1
PMID:16849698 "MicroRNAs from the Planarian Schmidtea mediterranea: a model system for stem cell biology" Palakodeti D, Smielewska M, Graveley BR RNA. 12:1640-1649(2006).
2
PMID:19564616 "High-resolution profiling and discovery of planarian small RNAs" Friedlander MR, Adamidi C, Han T, Lebedeva S, Isenbarger TA, Hirst M, Marra M, Nusbaum C, Lee WL, Jenkin JC, Sanchez Alvarado A, Kim JK, Rajewsky N Proc Natl Acad Sci U S A. 106:11546-11551(2009).
3
PMID:19553344 "Deep sequencing identifies new and regulated microRNAs in Schmidtea mediterranea" Lu YC, Smielewska M, Palakodeti D, Lovci MT, Aigner S, Yeo GW, Graveley BR RNA. 15:1483-1491(2009).