Stem-loop sequence sme-mir-1b

AccessionMI0005129 (change log)
DescriptionSchmidtea mediterranea miR-1b stem-loop
Stem-loop
        cacac  g         a       g  ag    uu 
5' aacaa     gg cauaauuca gauauuc au  gguu  u
   |||||     || ||||||||| ||||||| ||  ||||   
3' uuguu     cu guauuaagu cuguaag ua  ucaa  g
        -acuu  g         g       g  -a    ug 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (WUSTL3.1) Overlapping transcripts
Contig577: 101727-101808 [+]
intergenic
Clustered miRNAs
< 10kb from sme-mir-1b
sme-mir-1bContig577: 101727-101808 [+]
sme-mir-1cContig577: 106527-106605 [+]
Database links

Mature sequence sme-miR-1b-5p

Accession MIMAT0012091
Previous IDssme-miR-1b*
Sequence

12 - 

ggcauaauucaagauauucgau

 - 33

Get sequence
Evidence experimental; 454 [2], Illumina [2-3]

Mature sequence sme-miR-1b-3p

Accession MIMAT0003961
Previous IDssme-miR-1b
Sequence

52 - 

uggaaugucgugaauuaugguc

 - 73

Get sequence
Evidence experimental; cloned [1], Northern [1], 454 [2], Illumina [2]

References

1
PMID:16849698 "MicroRNAs from the Planarian Schmidtea mediterranea: a model system for stem cell biology" Palakodeti D, Smielewska M, Graveley BR RNA. 12:1640-1649(2006).
2
PMID:19564616 "High-resolution profiling and discovery of planarian small RNAs" Friedlander MR, Adamidi C, Han T, Lebedeva S, Isenbarger TA, Hirst M, Marra M, Nusbaum C, Lee WL, Jenkin JC, Sanchez Alvarado A, Kim JK, Rajewsky N Proc Natl Acad Sci U S A. 106:11546-11551(2009).
3
PMID:19553344 "Deep sequencing identifies new and regulated microRNAs in Schmidtea mediterranea" Lu YC, Smielewska M, Palakodeti D, Lovci MT, Aigner S, Yeo GW, Graveley BR RNA. 15:1483-1491(2009).