Stem-loop sequence sme-mir-2a-1

AccessionMI0005131 (change log)
DescriptionSchmidtea mediterranea miR-2a-1 stem-loop
Gene family MIPF0000049; mir-2
Stem-loop
          u  guga      -   -u   a         uuucua 
5' guucauu au    guucca gug  gcu ugauguaua      a
   ||||||| ||    |||||| |||  ||| |||||||||       
3' uaaguaa ua    caaggu cgc  cga acuauauau      a
          u  aucg      u   cc   c         cuuuaa 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (WUSTL3.1) Overlapping transcripts
Contig1403: 125998-126087 [+]
intergenic
Clustered miRNAs
< 10kb from sme-mir-2a-1
sme-mir-71a-1Contig1403: 125898-125981 [+]
sme-mir-2a-1Contig1403: 125998-126087 [+]
Database links

Mature sequence sme-miR-2a-1-5p

Accession MIMAT0003964
Previous IDssme-miR-2a*;sme-miR-2a-1*
Sequence

14 - 

aguuccagugugcuaugaugua

 - 35

Get sequence
Evidence experimental; 454 [2], Illumina [2-3]

Mature sequence sme-miR-2a-3p

Accession MIMAT0003963
Previous IDssme-miR-2a
Sequence

56 - 

uaucacagccccgcuuggaacgcu

 - 79

Get sequence
Evidence experimental; cloned [1], Northern [1], 454 [2], Illumina [2]

References

1
PMID:16849698 "MicroRNAs from the Planarian Schmidtea mediterranea: a model system for stem cell biology" Palakodeti D, Smielewska M, Graveley BR RNA. 12:1640-1649(2006).
2
PMID:19564616 "High-resolution profiling and discovery of planarian small RNAs" Friedlander MR, Adamidi C, Han T, Lebedeva S, Isenbarger TA, Hirst M, Marra M, Nusbaum C, Lee WL, Jenkin JC, Sanchez Alvarado A, Kim JK, Rajewsky N Proc Natl Acad Sci U S A. 106:11546-11551(2009).
3
PMID:19553344 "Deep sequencing identifies new and regulated microRNAs in Schmidtea mediterranea" Lu YC, Smielewska M, Palakodeti D, Lovci MT, Aigner S, Yeo GW, Graveley BR RNA. 15:1483-1491(2009).