Stem-loop sequence sme-mir-7b

AccessionMI0005137 (change log)
DescriptionSchmidtea mediterranea miR-7b stem-loop
Literature search

1 open access papers mention sme-mir-7b
(1 sentences)

Stem-loop
       --uaac          aa   u      c      uu       caga     u 
5' ggaa      acagaaaaau  uca ggaaga ugucga  ucguugu    gcauu u
   ||||      ||||||||||  ||| |||||| ||||||  |||||||    |||||  
3' ucuu      uguuuuuuua  ggu ccuucu auaguu  agcaaca    uguaa u
       caaagu          --   -      a      uu       ---a     a 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (WUSTL3.1) Overlapping transcripts
Contig511: 137580-137689 [+]
intergenic
Database links

Mature sequence sme-miR-7b-5p

Accession MIMAT0003970
Previous IDssme-miR-7b
Sequence

24 - 

uggaagacugucgauuucguugu

 - 46

Get sequence
Evidence experimental; cloned [1], 454 [2], Illumina [2-3]

Mature sequence sme-miR-7b-3p

Accession MIMAT0012097
Previous IDssme-miR-7b*
Sequence

67 - 

caacgauuuugauaaucuuccugga

 - 91

Get sequence
Evidence experimental; Illumina [2-3]

References

1
PMID:16849698 "MicroRNAs from the Planarian Schmidtea mediterranea: a model system for stem cell biology" Palakodeti D, Smielewska M, Graveley BR RNA. 12:1640-1649(2006).
2
PMID:19564616 "High-resolution profiling and discovery of planarian small RNAs" Friedlander MR, Adamidi C, Han T, Lebedeva S, Isenbarger TA, Hirst M, Marra M, Nusbaum C, Lee WL, Jenkin JC, Sanchez Alvarado A, Kim JK, Rajewsky N Proc Natl Acad Sci U S A. 106:11546-11551(2009).
3
PMID:19553344 "Deep sequencing identifies new and regulated microRNAs in Schmidtea mediterranea" Lu YC, Smielewska M, Palakodeti D, Lovci MT, Aigner S, Yeo GW, Graveley BR RNA. 15:1483-1491(2009).