Stem-loop sequence sme-mir-745

AccessionMI0005143 (change log)
DescriptionSchmidtea mediterranea miR-745 stem-loop
Stem-loop
   --auuaacuc   ga      -       -    c   a   c  aua 
5'           ugu  ugauac gcucuua ccag uag aug ug   a
             |||  |||||| ||||||| |||| ||| ||| ||   u
3'           aca  acugug cgagaau gguc guc uac ac   u
   caaacuuucc   -a      u       u    c   g   -  cau 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (WUSTL3.1) Overlapping transcripts
Contig2406: 24935-25027 [+]
intergenic
Database links

Mature sequence sme-miR-745-5p

Accession MIMAT0012102
Previous IDssme-miR-745*
Sequence

17 - 

uacgcucuuaccagcuagaau

 - 37

Get sequence
Evidence experimental; Illumina [2-3]

Mature sequence sme-miR-745-3p

Accession MIMAT0003977
Previous IDssme-miR-745
Sequence

55 - 

ugcugccugguuaagagcugugu

 - 77

Get sequence
Evidence experimental; cloned [1], Northern [1], 454 [2], Illumina [2]

References

1
PMID:16849698 "MicroRNAs from the Planarian Schmidtea mediterranea: a model system for stem cell biology" Palakodeti D, Smielewska M, Graveley BR RNA. 12:1640-1649(2006).
2
PMID:19564616 "High-resolution profiling and discovery of planarian small RNAs" Friedlander MR, Adamidi C, Han T, Lebedeva S, Isenbarger TA, Hirst M, Marra M, Nusbaum C, Lee WL, Jenkin JC, Sanchez Alvarado A, Kim JK, Rajewsky N Proc Natl Acad Sci U S A. 106:11546-11551(2009).
3
PMID:19553344 "Deep sequencing identifies new and regulated microRNAs in Schmidtea mediterranea" Lu YC, Smielewska M, Palakodeti D, Lovci MT, Aigner S, Yeo GW, Graveley BR RNA. 15:1483-1491(2009).