Stem-loop sequence sme-mir-746

AccessionMI0005144 (change log)
DescriptionSchmidtea mediterranea miR-746 stem-loop
Stem-loop
   ---    --aa    cauaaca  uag  g    a      u    auu    gaaa   aaau       u 
5'    ugau    uucg       uc   cc gaua auccug gugc   gaua    gug    gauuuua u
      ||||    ||||       ||   || |||| |||||| ||||   ||||    |||    |||||||  
3'    acua    aagc       ag   gg cuau ugggac cacg   cuau    cau    cuagaau c
   acu    guac    -----aa  uua  g    a      -    -au    --ac   ----       a 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (WUSTL3.1) Overlapping transcripts
Contig1695: 140627-140754 [-]
intergenic
Database links

Mature sequence sme-miR-746-5p

Accession MIMAT0012103
Sequence

22 - 

gccggauaaauccugugugcau

 - 43

Get sequence
Evidence experimental; 454 [2], Illumina [2-3]

Mature sequence sme-miR-746-3p

Accession MIMAT0003978
Previous IDssme-miR-746
Sequence

87 - 

uagcaccaggguauaucgggau

 - 108

Get sequence
Evidence experimental; cloned [1], 454 [2], Illumina [2-3]

References

1
PMID:16849698 "MicroRNAs from the Planarian Schmidtea mediterranea: a model system for stem cell biology" Palakodeti D, Smielewska M, Graveley BR RNA. 12:1640-1649(2006).
2
PMID:19564616 "High-resolution profiling and discovery of planarian small RNAs" Friedlander MR, Adamidi C, Han T, Lebedeva S, Isenbarger TA, Hirst M, Marra M, Nusbaum C, Lee WL, Jenkin JC, Sanchez Alvarado A, Kim JK, Rajewsky N Proc Natl Acad Sci U S A. 106:11546-11551(2009).
3
PMID:19553344 "Deep sequencing identifies new and regulated microRNAs in Schmidtea mediterranea" Lu YC, Smielewska M, Palakodeti D, Lovci MT, Aigner S, Yeo GW, Graveley BR RNA. 15:1483-1491(2009).