Stem-loop sequence sme-mir-71b

AccessionMI0005151 (change log)
DescriptionSchmidtea mediterranea miR-71b stem-loop
Gene family MIPF0000278; mir-71
Literature search

2 open access papers mention sme-mir-71b
(2 sentences)

Stem-loop
   -----         acuc             gg   u       auauuauc 
5'      ugauucagu    uuugaaagacaca  uag gggacag        u
        |||||||||    |||||||||||||  ||| |||||||         
3'      acuaaguua    aagcuuuuugugu  auc uccuguu        a
   uacua         ccaa             -a   u       cgaaaaua 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (WUSTL3.1) Overlapping transcripts
Contig1374: 32561-32660 [-]
intergenic
Clustered miRNAs
< 10kb from sme-mir-71b
sme-mir-71bContig1374: 32561-32660 [-]
sme-mir-2dContig1374: 32443-32550 [-]
sme-mir-752Contig1374: 32325-32438 [-]
sme-mir-13Contig1374: 32236-32295 [-]
Database links

Mature sequence sme-miR-71b-5p

Accession MIMAT0003985
Previous IDssme-miR-71b
Sequence

16 - 

ugaaagacacagguagugggac

 - 37

Get sequence
Evidence experimental; cloned [1], Northern [1], 454 [2], Illumina [2]

Mature sequence sme-miR-71b-3p

Accession MIMAT0003986
Previous IDssme-miR-71b*
Sequence

61 - 

uccuucuaauguguuuuucg

 - 80

Get sequence
Evidence experimental; cloned [1], 454 [2], Illumina [2-3]

References

1
PMID:16849698 "MicroRNAs from the Planarian Schmidtea mediterranea: a model system for stem cell biology" Palakodeti D, Smielewska M, Graveley BR RNA. 12:1640-1649(2006).
2
PMID:19564616 "High-resolution profiling and discovery of planarian small RNAs" Friedlander MR, Adamidi C, Han T, Lebedeva S, Isenbarger TA, Hirst M, Marra M, Nusbaum C, Lee WL, Jenkin JC, Sanchez Alvarado A, Kim JK, Rajewsky N Proc Natl Acad Sci U S A. 106:11546-11551(2009).
3
PMID:19553344 "Deep sequencing identifies new and regulated microRNAs in Schmidtea mediterranea" Lu YC, Smielewska M, Palakodeti D, Lovci MT, Aigner S, Yeo GW, Graveley BR RNA. 15:1483-1491(2009).