Stem-loop sequence sme-mir-71c

AccessionMI0005152 (change log)
DescriptionSchmidtea mediterranea miR-71c stem-loop
Gene family MIPF0000278; mir-71
Literature search

2 open access papers mention sme-mir-71c
(2 sentences)

Stem-loop
   gua    ucuu       a              au      u 
5'    guuu    gaaagac uggguagugagauu  uuaaau a
      ||||    ||||||| ||||||||||||||  |||||| a
3'    cgaa    cuuuuug acuuauuacucuaa  aauuua a
   ---    uauu       a              --      u 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (WUSTL3.1) Overlapping transcripts
Contig297: 116135-116216 [-]
intergenic
Clustered miRNAs
< 10kb from sme-mir-71c
sme-mir-71cContig297: 116135-116216 [-]
sme-mir-2cContig297: 116024-116116 [-]
Database links

Mature sequence sme-miR-71c-5p

Accession MIMAT0003987
Previous IDssme-miR-71c
Sequence

11 - 

ugaaagacauggguagugagau

 - 32

Get sequence
Evidence experimental; cloned [1], Northern [1], 454 [2], Illumina [2]

Mature sequence sme-miR-71c-3p

Accession MIMAT0012107
Previous IDssme-miR-71c*
Sequence

55 - 

ucucauuauucaaguuuuucuua

 - 77

Get sequence
Evidence experimental; 454 [2], Illumina [2-3]

References

1
PMID:16849698 "MicroRNAs from the Planarian Schmidtea mediterranea: a model system for stem cell biology" Palakodeti D, Smielewska M, Graveley BR RNA. 12:1640-1649(2006).
2
PMID:19564616 "High-resolution profiling and discovery of planarian small RNAs" Friedlander MR, Adamidi C, Han T, Lebedeva S, Isenbarger TA, Hirst M, Marra M, Nusbaum C, Lee WL, Jenkin JC, Sanchez Alvarado A, Kim JK, Rajewsky N Proc Natl Acad Sci U S A. 106:11546-11551(2009).
3
PMID:19553344 "Deep sequencing identifies new and regulated microRNAs in Schmidtea mediterranea" Lu YC, Smielewska M, Palakodeti D, Lovci MT, Aigner S, Yeo GW, Graveley BR RNA. 15:1483-1491(2009).