Stem-loop sequence sme-mir-87a

AccessionMI0005154 (change log)
DescriptionSchmidtea mediterranea miR-87a stem-loop
Gene family MIPF0000152; mir-87
Stem-loop
   ---uu     -    uuca        uaa       aa    aug   g 
5'      ugcca guau    acacuugg   uuugcuc  acca   ucc a
        ||||| ||||    ||||||||   |||||||  ||||   ||| a
3'      acggu uaua    ugugaacu   aaacgag  uggu   agg a
   aaauu     g    --ua        uug       --    cug   a 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (WUSTL3.1) Overlapping transcripts
Contig961: 4077-4171 [+]
intergenic
Database links

Mature sequence sme-miR-87a-5p

Accession MIMAT0012109
Sequence

15 - 

aacacuugguaauuugcucaaacc

 - 38

Get sequence
Evidence experimental; 454 [2], Illumina [2-3]

Mature sequence sme-miR-87a-3p

Accession MIMAT0003989
Previous IDssme-miR-87a
Sequence

60 - 

ugagcaaaguuucaagugua

 - 79

Get sequence
Evidence experimental; cloned [1], 454 [2], Illumina [2-3]

References

1
PMID:16849698 "MicroRNAs from the Planarian Schmidtea mediterranea: a model system for stem cell biology" Palakodeti D, Smielewska M, Graveley BR RNA. 12:1640-1649(2006).
2
PMID:19564616 "High-resolution profiling and discovery of planarian small RNAs" Friedlander MR, Adamidi C, Han T, Lebedeva S, Isenbarger TA, Hirst M, Marra M, Nusbaum C, Lee WL, Jenkin JC, Sanchez Alvarado A, Kim JK, Rajewsky N Proc Natl Acad Sci U S A. 106:11546-11551(2009).
3
PMID:19553344 "Deep sequencing identifies new and regulated microRNAs in Schmidtea mediterranea" Lu YC, Smielewska M, Palakodeti D, Lovci MT, Aigner S, Yeo GW, Graveley BR RNA. 15:1483-1491(2009).