Stem-loop sequence sme-mir-124a

AccessionMI0005157 (change log)
DescriptionSchmidtea mediterranea miR-124a stem-loop
Gene family MIPF0000021; mir-124
Literature search

2 open access papers mention sme-mir-124a
(7 sentences)

Stem-loop
   u        a  u  u    a    ga         auuua 
5'  ucaaucag ug gc uuua cgcg  gcuuuagua     a
    |||||||| || || |||| ||||  |||||||||      
3'  aguuaguu au cg aagu gcgc  cggaaucau     c
   g        c  u  u    g    -a         augua 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (WUSTL3.1) Overlapping transcripts
Contig19989: 5815-5897 [-]
intergenic
Contig3630: 2663-2745 [+]
intergenic
Database links

Mature sequence sme-miR-124a-5p

Accession MIMAT0012112
Previous IDssme-miR-124a*
Sequence

13 - 

ugcuuuuaacgcggagcuuuagu

 - 35

Get sequence
Evidence experimental; 454 [2], Illumina [2-3]

Mature sequence sme-miR-124a-3p

Accession MIMAT0003992
Previous IDssme-miR-124a
Sequence

52 - 

uaaggcacgcggugaaugcuu

 - 72

Get sequence
Evidence experimental; cloned [1], Northern [1], 454 [2], Illumina [2]

References

1
PMID:16849698 "MicroRNAs from the Planarian Schmidtea mediterranea: a model system for stem cell biology" Palakodeti D, Smielewska M, Graveley BR RNA. 12:1640-1649(2006).
2
PMID:19564616 "High-resolution profiling and discovery of planarian small RNAs" Friedlander MR, Adamidi C, Han T, Lebedeva S, Isenbarger TA, Hirst M, Marra M, Nusbaum C, Lee WL, Jenkin JC, Sanchez Alvarado A, Kim JK, Rajewsky N Proc Natl Acad Sci U S A. 106:11546-11551(2009).
3
PMID:19553344 "Deep sequencing identifies new and regulated microRNAs in Schmidtea mediterranea" Lu YC, Smielewska M, Palakodeti D, Lovci MT, Aigner S, Yeo GW, Graveley BR RNA. 15:1483-1491(2009).