Stem-loop sequence sme-mir-133b

AccessionMI0005162 (change log)
Previous IDssme-mir-133
DescriptionSchmidtea mediterranea miR-133b stem-loop
Stem-loop
   --a        uuguau      cua     u a     a   g 
5'    aaacacuu      uugcug   gaugg g aucaa acc u
      ||||||||      ||||||   ||||| | ||||| ||| u
3'    uuugugaa      aacgac   cuacc c ugguu ugg u
   cua        -cuuuu      caa     - c     c   g 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (WUSTL3.1) Overlapping transcripts
Contig23301: 4584-4670 [+]
intergenic
Database links

Mature sequence sme-miR-133b-5p

Accession MIMAT0012115
Sequence

17 - 

ugcugcuagauggugaauc

 - 35

Get sequence
Evidence experimental; Illumina [2]

Mature sequence sme-miR-133b-3p

Accession MIMAT0003999
Previous IDssme-miR-133
Sequence

51 - 

uugguccccaucaaccagca

 - 70

Get sequence
Evidence experimental; cloned [1], Illumina [2]

References

1
PMID:16849698 "MicroRNAs from the Planarian Schmidtea mediterranea: a model system for stem cell biology" Palakodeti D, Smielewska M, Graveley BR RNA. 12:1640-1649(2006).
2
PMID:19553344 "Deep sequencing identifies new and regulated microRNAs in Schmidtea mediterranea" Lu YC, Smielewska M, Palakodeti D, Lovci MT, Aigner S, Yeo GW, Graveley BR RNA. 15:1483-1491(2009).