Stem-loop sequence sme-mir-190a

AccessionMI0005164 (change log)
DescriptionSchmidtea mediterranea miR-190a stem-loop
Stem-loop
          uu ga              au     aua 
5' gauuaac  c  gauauguuugguua  uggug   g
   |||||||  |  ||||||||||||||  |||||   g
3' uuaauug  g  cuauacgagccagu  accac   u
          uu ac              -c     caa 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (WUSTL3.1) Overlapping transcripts
Contig9045: 10743-10816 [-]
intergenic
Database links

Mature sequence sme-miR-190a-5p

Accession MIMAT0004001
Previous IDssme-miR-190a
Sequence

12 - 

agauauguuugguuaauugguga

 - 34

Get sequence
Evidence experimental; cloned [1], 454 [2], Illumina [2-3]

Mature sequence sme-miR-190a-3p

Accession MIMAT0004002
Previous IDssme-miR-190a*
Sequence

44 - 

accacugaccgagcauaucca

 - 64

Get sequence
Evidence experimental; cloned [1], Northern [1], 454 [2], Illumina [2]

References

1
PMID:16849698 "MicroRNAs from the Planarian Schmidtea mediterranea: a model system for stem cell biology" Palakodeti D, Smielewska M, Graveley BR RNA. 12:1640-1649(2006).
2
PMID:19564616 "High-resolution profiling and discovery of planarian small RNAs" Friedlander MR, Adamidi C, Han T, Lebedeva S, Isenbarger TA, Hirst M, Marra M, Nusbaum C, Lee WL, Jenkin JC, Sanchez Alvarado A, Kim JK, Rajewsky N Proc Natl Acad Sci U S A. 106:11546-11551(2009).
3
PMID:19553344 "Deep sequencing identifies new and regulated microRNAs in Schmidtea mediterranea" Lu YC, Smielewska M, Palakodeti D, Lovci MT, Aigner S, Yeo GW, Graveley BR RNA. 15:1483-1491(2009).