![]() |
miRBase |
![]() |
![]() |
Stem-loop sequence sme-mir-190b |
|||||
Accession | MI0005165 (change log) | ||||
Description | Schmidtea mediterranea miR-190b stem-loop | ||||
Stem-loop |
u -au u uau --------- g 5' gcacu caa cgugauauguu gguu uggug agu u ||||| ||| ||||||||||| |||| ||||| ||| 3' cguga guu gugcuauguaa ccga accac uca a - acu u -uu aaucuuuag a |
||||
Confidence |
Annotation confidence: not enough data
| ||||
Genome context |
|
||||
Database links |
|
Mature sequence sme-miR-190b-5p |
|
Accession | MIMAT0004003 |
Previous IDs | sme-miR-190b |
Sequence |
14 - ugauauguuugguuuauugguga - 36 |
Evidence | experimental; cloned [1], 454 [2], Illumina [2-3] |
Mature sequence sme-miR-190b-3p |
|
Accession | MIMAT0004004 |
Previous IDs | sme-miR-190b* |
Sequence |
56 - accauuagccuaauguaucgugu - 78 |
Evidence | experimental; cloned [1], 454 [2], Illumina [2-3] |
References |
|
1 |
PMID:16849698
"MicroRNAs from the Planarian Schmidtea mediterranea: a model system for stem cell biology"
RNA. 12:1640-1649(2006).
|
2 |
PMID:19564616
"High-resolution profiling and discovery of planarian small RNAs"
Proc Natl Acad Sci U S A. 106:11546-11551(2009).
|
3 |
PMID:19553344
"Deep sequencing identifies new and regulated microRNAs in Schmidtea mediterranea"
RNA. 15:1483-1491(2009).
|