Stem-loop sequence sme-mir-747

AccessionMI0005166 (change log)
DescriptionSchmidtea mediterranea miR-747 stem-loop
Stem-loop
      g   u   c       c uc       u     ga   a   u 
5' uca uuc guu auaaucu a  ugguaau gaagu  ucu uuu u
   ||| ||| ||| ||||||| |  ||||||| |||||  ||| ||| u
3' agu aag uaa uguuaga u  acuauua cuuca  aga aaa a
      a   c   -       c uu       -     -a   a   a 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (WUSTL3.1) Overlapping transcripts
Contig1616: 21999-22090 [-]
intergenic
Clustered miRNAs
< 10kb from sme-mir-747
sme-mir-747Contig1616: 21999-22090 [-]
sme-mir-2158Contig1616: 21867-21968 [-]
Database links

Mature sequence sme-miR-747-5p

Accession MIMAT0004005
Previous IDssme-miR-747
Sequence

14 - 

uaaucucaucugguaauugaagu

 - 36

Get sequence
Evidence experimental; cloned [1], 454 [2], Illumina [2-3]

Mature sequence sme-miR-747-3p

Accession MIMAT0012117
Sequence

60 - 

cuucauuaucauuucagauugua

 - 82

Get sequence
Evidence experimental; 454 [2], Illumina [2-3]

References

1
PMID:16849698 "MicroRNAs from the Planarian Schmidtea mediterranea: a model system for stem cell biology" Palakodeti D, Smielewska M, Graveley BR RNA. 12:1640-1649(2006).
2
PMID:19564616 "High-resolution profiling and discovery of planarian small RNAs" Friedlander MR, Adamidi C, Han T, Lebedeva S, Isenbarger TA, Hirst M, Marra M, Nusbaum C, Lee WL, Jenkin JC, Sanchez Alvarado A, Kim JK, Rajewsky N Proc Natl Acad Sci U S A. 106:11546-11551(2009).
3
PMID:19553344 "Deep sequencing identifies new and regulated microRNAs in Schmidtea mediterranea" Lu YC, Smielewska M, Palakodeti D, Lovci MT, Aigner S, Yeo GW, Graveley BR RNA. 15:1483-1491(2009).