Stem-loop sequence sme-mir-277a

AccessionMI0005168 (change log)
DescriptionSchmidtea mediterranea miR-277a stem-loop
Literature search

1 open access papers mention sme-mir-277a
(2 sentences)

Stem-loop
   ugg        uu   -uua        u   a      u    aa 
5'    uaaacugu  ucu    cguauucg ugg gcauuu uaca  c
      ||||||||  |||    |||||||| ||| |||||| ||||  a
3'    auuugaca  aga    guauaggc auc cguaaa augu  a
   --a        -u   uaca        u   a      u    aa 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (WUSTL3.1) Overlapping transcripts
Contig23836: 3905-3995 [-]
intergenic
Clustered miRNAs
< 10kb from sme-mir-277a
sme-mir-277bContig23836: 4203-4283 [-]
sme-mir-277aContig23836: 3905-3995 [-]
Database links

Mature sequence sme-miR-277a-5p

Accession MIMAT0012119
Previous IDssme-miR-277a*
Sequence

19 - 

acguauucguuggagcauuuu

 - 39

Get sequence
Evidence experimental; 454 [2], Illumina [2-3]

Mature sequence sme-miR-277a-3p

Accession MIMAT0004007
Previous IDssme-miR-277a
Sequence

55 - 

uaaaugcacuaucggauaugac

 - 76

Get sequence
Evidence experimental; cloned [1], Northern [1], 454 [2], Illumina [2]

References

1
PMID:16849698 "MicroRNAs from the Planarian Schmidtea mediterranea: a model system for stem cell biology" Palakodeti D, Smielewska M, Graveley BR RNA. 12:1640-1649(2006).
2
PMID:19564616 "High-resolution profiling and discovery of planarian small RNAs" Friedlander MR, Adamidi C, Han T, Lebedeva S, Isenbarger TA, Hirst M, Marra M, Nusbaum C, Lee WL, Jenkin JC, Sanchez Alvarado A, Kim JK, Rajewsky N Proc Natl Acad Sci U S A. 106:11546-11551(2009).
3
PMID:19553344 "Deep sequencing identifies new and regulated microRNAs in Schmidtea mediterranea" Lu YC, Smielewska M, Palakodeti D, Lovci MT, Aigner S, Yeo GW, Graveley BR RNA. 15:1483-1491(2009).