Stem-loop sequence sme-mir-277b

AccessionMI0005169 (change log)
DescriptionSchmidtea mediterranea miR-277b stem-loop
Literature search

1 open access papers mention sme-mir-277b
(2 sentences)

Stem-loop
   -    g    ga     au    -      gc    g  aa 
5'  gguu uauu  ucuug  caga aaugca  uuca ag  a
    |||| ||||  |||||  |||| ||||||  |||| ||   
3'  ccga guaa  agaac  gucu uuacgu  aagu uc  u
   u    a    -a     cg    a      aa    g  ac 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (WUSTL3.1) Overlapping transcripts
Contig23836: 4203-4283 [-]
intergenic
Clustered miRNAs
< 10kb from sme-mir-277b
sme-mir-277bContig23836: 4203-4283 [-]
sme-mir-277aContig23836: 3905-3995 [-]
Database links

Mature sequence sme-miR-277b-5p

Accession MIMAT0004008
Previous IDssme-miR-277b*
Sequence

14 - 

uugaucagaaaugcagcuuc

 - 33

Get sequence
Evidence experimental; cloned [1], Illumina [2-3]

Mature sequence sme-miR-277b-3p

Accession MIMAT0004009
Previous IDssme-miR-277b
Sequence

49 - 

aaaaugcauuaucuggccaaga

 - 70

Get sequence
Evidence experimental; cloned [1], Northern [1], Illumina [2]

References

1
PMID:16849698 "MicroRNAs from the Planarian Schmidtea mediterranea: a model system for stem cell biology" Palakodeti D, Smielewska M, Graveley BR RNA. 12:1640-1649(2006).
2
PMID:19564616 "High-resolution profiling and discovery of planarian small RNAs" Friedlander MR, Adamidi C, Han T, Lebedeva S, Isenbarger TA, Hirst M, Marra M, Nusbaum C, Lee WL, Jenkin JC, Sanchez Alvarado A, Kim JK, Rajewsky N Proc Natl Acad Sci U S A. 106:11546-11551(2009).
3
PMID:19553344 "Deep sequencing identifies new and regulated microRNAs in Schmidtea mediterranea" Lu YC, Smielewska M, Palakodeti D, Lovci MT, Aigner S, Yeo GW, Graveley BR RNA. 15:1483-1491(2009).