Stem-loop sequence sme-mir-277c

AccessionMI0005170 (change log)
DescriptionSchmidtea mediterranea miR-277c stem-loop
Literature search

1 open access papers mention sme-mir-277c
(2 sentences)

Stem-loop
          auauua            -u      au    -   aa 
5' aucauuu      aucauaucagau  ugcauu  uauu aug  u
   |||||||      ||||||||||||  ||||||  |||| |||  u
3' uaguaaa      uaguauggucua  acguaa  auaa uac  a
          -guuua            uu      --    c   aa 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (WUSTL3.1) Overlapping transcripts
Contig520: 104019-104106 [+]
intergenic
Clustered miRNAs
< 10kb from sme-mir-277c
sme-mir-277dContig520: 103909-103989 [+]
sme-mir-277cContig520: 104019-104106 [+]
Database links

Mature sequence sme-miR-277c-5p

Accession MIMAT0012120
Previous IDssme-miR-277c*
Sequence

14 - 

aucauaucagauuugcauuauu

 - 35

Get sequence
Evidence experimental; 454 [2], Illumina [2-3]

Mature sequence sme-miR-277c-3p

Accession MIMAT0004010
Previous IDssme-miR-277c
Sequence

55 - 

uaaaugcauuaucugguaugau

 - 76

Get sequence
Evidence experimental; cloned [1], Northern [1], 454 [2], Illumina [2]

References

1
PMID:16849698 "MicroRNAs from the Planarian Schmidtea mediterranea: a model system for stem cell biology" Palakodeti D, Smielewska M, Graveley BR RNA. 12:1640-1649(2006).
2
PMID:19564616 "High-resolution profiling and discovery of planarian small RNAs" Friedlander MR, Adamidi C, Han T, Lebedeva S, Isenbarger TA, Hirst M, Marra M, Nusbaum C, Lee WL, Jenkin JC, Sanchez Alvarado A, Kim JK, Rajewsky N Proc Natl Acad Sci U S A. 106:11546-11551(2009).
3
PMID:19553344 "Deep sequencing identifies new and regulated microRNAs in Schmidtea mediterranea" Lu YC, Smielewska M, Palakodeti D, Lovci MT, Aigner S, Yeo GW, Graveley BR RNA. 15:1483-1491(2009).