Stem-loop sequence sme-mir-67

AccessionMI0005173 (change log)
DescriptionSchmidtea mediterranea miR-67 stem-loop
Gene family MIPF0000293; mir-67
Stem-loop
   -    aau    g    a   -uau       u        
5'  gugu   auua ccuc uuc    ggguugu augaugc 
    ||||   |||| |||| |||    ||||||| |||||| a
3'  uaca   uaau ggag aag    uccaaca uacuaua 
   g    -gc    g    c   uacc       c        
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (WUSTL3.1) Overlapping transcripts
Contig1175: 63427-63504 [-]
intergenic
Database links

Mature sequence sme-miR-67-5p

Accession MIMAT0012122
Sequence

12 - 

gccucauucuauggguuguuau

 - 33

Get sequence
Evidence experimental; 454 [2], Illumina [2-3]

Mature sequence sme-miR-67-3p

Accession MIMAT0004014
Previous IDssme-miR-67
Sequence

46 - 

ucacaaccuccaugaacgagggu

 - 68

Get sequence
Evidence experimental; cloned [1], 454 [2], Illumina [2-3]

References

1
PMID:16849698 "MicroRNAs from the Planarian Schmidtea mediterranea: a model system for stem cell biology" Palakodeti D, Smielewska M, Graveley BR RNA. 12:1640-1649(2006).
2
PMID:19564616 "High-resolution profiling and discovery of planarian small RNAs" Friedlander MR, Adamidi C, Han T, Lebedeva S, Isenbarger TA, Hirst M, Marra M, Nusbaum C, Lee WL, Jenkin JC, Sanchez Alvarado A, Kim JK, Rajewsky N Proc Natl Acad Sci U S A. 106:11546-11551(2009).
3
PMID:19553344 "Deep sequencing identifies new and regulated microRNAs in Schmidtea mediterranea" Lu YC, Smielewska M, Palakodeti D, Lovci MT, Aigner S, Yeo GW, Graveley BR RNA. 15:1483-1491(2009).