|
miRBase |
|
Stem-loop sequence sme-mir-748 |
|||||
| Accession | MI0005174 | ||||
| Description | Schmidtea mediterranea miR-748 stem-loop | ||||
| Stem-loop |
caa -uua gu g a a ucaca u ccuuauuauauu cuguc agua g ||||| | |||||||||||| ||||| |||| c agugu a ggaguaauguga ggcag ucau a -aa uaaa ug a g c |
||||
| Genome context |
|
||||
Mature sequence sme-miR-748-5p |
|
| Accession | MIMAT0012123 |
| Previous IDs | sme-miR-748* |
| Sequence |
14 - uccuuauuauauugcugucaagu - 36 |
| Evidence | experimental; Solexa [2-3] |
Mature sequence sme-miR-748-3p |
|
| Accession | MIMAT0004015 |
| Previous IDs | sme-miR-748 |
| Sequence |
46 - uggacggaaguguaaugag - 64 |
| Evidence | experimental; cloned [1], Northern [1], 454 [2], Solexa [2] |
References |
|
| 1 |
PMID:16849698
"MicroRNAs from the Planarian Schmidtea mediterranea: a model system for stem cell biology"
RNA. 12:1640-1649(2006).
|
| 2 |
PMID:19564616
"High-resolution profiling and discovery of planarian small RNAs"
Proc Natl Acad Sci U S A. 106:11546-11551(2009).
|
| 3 |
PMID:19553344
"Deep sequencing identifies new and regulated microRNAs in Schmidtea mediterranea"
RNA. 15:1483-1491(2009).
|