Stem-loop sequence sme-mir-750

AccessionMI0005176 (change log)
DescriptionSchmidtea mediterranea miR-750 stem-loop
Literature search

1 open access papers mention sme-mir-750
(1 sentences)

Stem-loop
   -a   aa     a    c  c        gu    uuuag   -     cac  uc 
5'   uug  aucag uuuu ag acuggaag  uugg     cug cugug   cg  a
     |||  ||||| |||| || ||||||||  ||||     ||| |||||   ||   
3'   agc  uaguc gaaa uc ugaccuuc  aauc     gac gacac   gc  u
   ca   ga     -    -  u        uc    ---ua   u     --a  ug 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (WUSTL3.1) Overlapping transcripts
Contig1078: 22657-22761 [+]
intergenic
Clustered miRNAs
< 10kb from sme-mir-750
sme-mir-750Contig1078: 22657-22761 [+]
sme-mir-755Contig1078: 22802-22873 [+]
Database links

Mature sequence sme-miR-750-5p

Accession MIMAT0012124
Sequence

19 - 

gcacuggaagguuugguuuagcu

 - 41

Get sequence
Evidence experimental; 454 [2], Illumina [2-3]

Mature sequence sme-miR-750-3p

Accession MIMAT0004017
Previous IDssme-miR-750
Sequence

67 - 

ucagaucuaacucuuccaguucu

 - 89

Get sequence
Evidence experimental; cloned [1], Northern [1], 454 [2], Illumina [2]

References

1
PMID:16849698 "MicroRNAs from the Planarian Schmidtea mediterranea: a model system for stem cell biology" Palakodeti D, Smielewska M, Graveley BR RNA. 12:1640-1649(2006).
2
PMID:19564616 "High-resolution profiling and discovery of planarian small RNAs" Friedlander MR, Adamidi C, Han T, Lebedeva S, Isenbarger TA, Hirst M, Marra M, Nusbaum C, Lee WL, Jenkin JC, Sanchez Alvarado A, Kim JK, Rajewsky N Proc Natl Acad Sci U S A. 106:11546-11551(2009).
3
PMID:19553344 "Deep sequencing identifies new and regulated microRNAs in Schmidtea mediterranea" Lu YC, Smielewska M, Palakodeti D, Lovci MT, Aigner S, Yeo GW, Graveley BR RNA. 15:1483-1491(2009).