Stem-loop sequence cel-mir-790

AccessionMI0005191 (change log)
DescriptionCaenorhabditis elegans miR-790 stem-loop
Gene family MIPF0000362; mir-790
Literature search

1 open access papers mention cel-mir-790
(1 sentences)

Stem-loop
        c       -uc  g   a      uuuca 
5' gccgg uuggcac   gc aac ccgcga     c
   ||||| |||||||   || ||| ||||||     u
3' cggcc aacugug   cg uug ggcgcu     u
        a       ucu  a   c      caaua 
Get sequence
Deep sequencing
12378 reads, 25 reads per million, 16 experiments
Confidence Annotation confidence: high
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (WBcel235; GCA_000002985.3) Overlapping transcripts
chrIV: 5566422-5566491 [+]
intergenic
Clustered miRNAs
< 10kb from cel-mir-790
cel-mir-228chrIV: 5562025-5562122 [+]
cel-mir-790chrIV: 5566422-5566491 [+]
Database links

Mature sequence cel-miR-790-5p

Accession MIMAT0004225
Previous IDscel-miR-790
Sequence

6 - 

cuuggcacucgcgaacaccgcg

 - 27

Get sequence
Deep sequencing12276 reads, 16 experiments
Evidence experimental; 454 [1], Illumina [2-3]
Database links
Predicted targets

Mature sequence cel-miR-790-3p

Accession MIMAT0020349
Previous IDscel-miR-790*
Sequence

45 - 

cggcguuagcucugugucaaacc

 - 67

Get sequence
Deep sequencing102 reads, 12 experiments
Evidence experimental; Illumina [3]
Database links

References

1
PMID:17174894 "Large-scale sequencing reveals 21U-RNAs and additional microRNAs and endogenous siRNAs in C. elegans" Ruby JG, Jan C, Player C, Axtell MJ, Lee W, Nusbaum C, Ge H, Bartel DP Cell. 127:1193-1207(2006).
2
3