![]() |
miRBase |
![]() |
![]() |
Stem-loop sequence osa-MIR812c |
|||||
Accession | MI0005235 (change log) | ||||
Description | Oryza sativa miR812c stem-loop | ||||
Gene family | MIPF0000345; MIR812 | ||||
Literature search |
![]()
9 open access papers mention osa-MIR812c | ||||
Stem-loop |
c a u aaaaaauuaaaaacauaagucaugcauaaaauauuauucaug 5' gguuuccg gucuaauguuugaccgucc ucuuau uga u |||||||| ||||||||||||||||||| |||||| ||| 3' ccaaaggc cagguugcaaauuggcagg agaaua auu u a c u aaaaaaaaauacuaaccacaauaauaauaacaauuuacuauu |
||||
Deep sequencing |
| ||||
Confidence |
Annotation confidence: not enough data
| ||||
Comments |
miR812 was misnamed miR569 by Luo et al [1]. |
||||
Genome context |
|
||||
Database links |
|
Mature sequence osa-miR812c |
|
Accession | MIMAT0004051 |
Sequence |
134 - gacggacgguuaaacguuggac - 155 |
Deep sequencing | 4378 reads, 2 experiments |
Evidence | experimental; cloned [1], Northern [1] |
Database links |
|
References |
|
1 |
PMID:16959252
"Rice embryogenic calli express a unique set of microRNAs, suggesting regulatory roles of microRNAs in plant post-embryogenic development"
FEBS Lett. 580:5111-5116(2006).
|