Stem-loop sequence mdo-let-7g

AccessionMI0005331 (change log)
DescriptionMonodelphis domestica let-7g stem-loop
Gene family MIPF0000002; let-7
Stem-loop
   a   u        a            ugagg    -a  a    a 
5'  ggc gagguagu guuuguacaguu     gucu  ug uacc c
    ||| |||||||| ||||||||||||     ||||  || ||||  
3'  ccg uuccguca cggacaugucaa     uaga  ac augg c
   -   -        c            -----    gg  -    c 
Get sequence
Deep sequencing
4923600 reads, 8.08e+04 reads per million, 5 experiments
Confidence Annotation confidence: high
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (MonDom5; GCF_000002295.2) Overlapping transcripts
chr6: 277022691-277022773 [+]
sense
ENSMODT00000028277 ; mdo-let-7g-201; exon 1
Database links

Mature sequence mdo-let-7g-5p

Accession MIMAT0004142
Sequence

5 - 

ugagguaguaguuuguacagu

 - 25

Get sequence
Deep sequencing4923368 reads, 5 experiments
Evidence experimental; Illumina [2]
Database links
Predicted targets

Mature sequence mdo-let-7g-3p

Accession MIMAT0026687
Sequence

62 - 

cuguacaggccacugccuugcc

 - 83

Get sequence
Deep sequencing232 reads, 5 experiments
Evidence experimental; Illumina [2]
Predicted targets

References

1
2
PMID:23034410 "Birth and expression evolution of mammalian microRNA genes" Meunier J, Lemoine F, Soumillon M, Liechti A, Weier M, Guschanski K, Hu H, Khaitovich P, Kaessmann H Genome Res. 23:34-45(2013).