Stem-loop sequence mdo-let-7i

AccessionMI0005332 (change log)
DescriptionMonodelphis domestica let-7i stem-loop
Gene family MIPF0000002; let-7
Stem-loop
   c    u                 u   --------  u     ugu 
5'  uggc gagguaguaguuugugc guu        gg cgggu   g
    |||| ||||||||||||||||| |||        || |||||   a
3'  aucg uuccgucaucgaacgcg caa        uc gcccg   c
   -    -                 u   uagaggug  -     uua 
Get sequence
Deep sequencing
338827 reads, 4.86e+03 reads per million, 5 experiments
Confidence Annotation confidence: high
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (MonDom5; GCF_000002295.2) Overlapping transcripts
chr8: 22252146-22252229 [+]
sense
ENSMODT00000028335 ; mdo-let-7i-201; exon 1
Database links

Mature sequence mdo-let-7i-5p

Accession MIMAT0004143
Sequence

6 - 

ugagguaguaguuugugcugu

 - 26

Get sequence
Deep sequencing338357 reads, 5 experiments
Evidence experimental; Illumina [2]
Database links
Predicted targets

Mature sequence mdo-let-7i-3p

Accession MIMAT0026688
Sequence

63 - 

ugcgcaagcuacugccuugcu

 - 83

Get sequence
Deep sequencing464 reads, 5 experiments
Evidence experimental; Illumina [2]
Predicted targets

References

1
2
PMID:23034410 "Birth and expression evolution of mammalian microRNA genes" Meunier J, Lemoine F, Soumillon M, Liechti A, Weier M, Guschanski K, Hu H, Khaitovich P, Kaessmann H Genome Res. 23:34-45(2013).