MIR675 is a microRNA encoded by the long non-coding RNA (lncRNA) H19, which plays a role in cellular proliferation [PMC4741653]. In the context of tumor growth, a significant reduction in the proliferation marker Ki67 was observed in tumors where MIR675 was knocked down, indicating that MIR675 may contribute to tumor cell proliferation [PMC4741653]. Specifically, Ki67 positive cells were markedly fewer in MIR675 knockdown tumors compared to controls [PMC4741653]. Despite these findings, it is important to note that the implications of MIR675 and its parent lncRNA H19 have not been explored in heterotopic ossification (HO) patients or animal models of HO formation [PMC9753082]. This gap highlights an area for future research to understand the potential role of MIR675 in HO development and its underlying mechanisms [PMC9753082].
u U A CC gacu cccaggg cUGG GCGG GAGGGC ACAGUG u ||||||| |||| |||| |||||| |||||| ggguccc gACU CGCC CUCCCG UGUCgc g c - A UA agug
Disease | Description | Category | PubMed ID |
---|
Accession | MIMAT0004284 |
Description | Homo sapiens hsa-miR-675-5p mature miRNA |
Sequence | 10 - UGGUGCGGAGAGGGCCCACAGUG - 32 |
Evidence |
experimental
cloned [1] |
Database links |
![]() ![]() ![]() |
Predicted targets |
![]() ![]() ![]() |
Accession | MIMAT0006790 |
Description | Homo sapiens hsa-miR-675-3p mature miRNA |
Sequence | 45 - CUGUAUGCCCUCACCGCUCA - 64 |
Evidence |
experimental
cloned [2] |
Database links |
![]() ![]() ![]() |
Predicted targets |
![]() ![]() ![]() |
|