|
miRBase |
|
Stem-loop sequence ath-MIR860 |
|||||
| Accession | MI0005437 | ||||
| Description | Arabidopsis thaliana miR860 stem-loop | ||||
| Gene family | MIPF0001176; MIR860 | ||||
| Stem-loop |
g c g a ua -- cu
au ucuugguuaaauu aauauauauaguccaaucuauugaa uacu g cac cagcu a
|| ||||||||||||| ||||||||||||||||||||||||| |||| | ||| |||||
ua agaaucaguuuaa uuauauguaucagguuagauaacuu auga u gug gucga a
g a g a gg ua au
|
||||
| Deep sequencing |
| ||||
| Genome context |
|
||||
Mature sequence ath-miR860 |
|
| Accession | MIMAT0004304 |
| Sequence |
86 - ucaauagauuggacuauguau - 106 |
| Deep sequencing | 55 reads, 8 experiments |
| Evidence | experimental; 454 [1], cloned [1], Solexa [2] |
| Validated targets |
|
References |
|
| 1 |
PMID:17299599
"High-throughput sequencing of Arabidopsis microRNAs: evidence for frequent birth and death of MIRNA genes"
PLoS One. 2:e219(2007).
|
| 2 |
PMID:19815687
"Hypoxia-responsive microRNAs and trans-acting small interfering RNAs in Arabidopsis"
J Exp Bot. 61:165-177(2010).
|