miRBase entry: bta-let-7c

Stem-loop bta-let-7c


Accession
MI0005454
Description
Bos taurus bta-let-7c precursor miRNA

Summary
Caution, this is an AI generated summary based on literature. This may have errors. ?

WARNING: This summary was generated by AI. Bta-let-7c is a member of the let-7 family of microRNAs, which are small, non-coding RNA molecules involved in the regulation of gene expression [PMC5999645]. This microRNA was found to be significantly upregulated in placental exosomes compared to non-pregnant exosomes, indicating a potential role in pregnancy [PMC5999645]. Bta-let-7c expression was also significantly altered by exosome treatment, suggesting its involvement in cellular communication [PMC5999645]. Furthermore, bta-let-7c has been implicated in the regulation of inflammatory responses as its overexpression can decrease the expression of proinflammatory cytokines and NRAS [PMC5999645]. It has been observed to be upregulated following LPS challenge in bubaline PBMCs and mice whole blood, which may indicate a role in immune responses [PMC4892552]. Bta-let-7c is also among the most abundant miRNAs across various developmental stages and is considered an important nutritional component of milk across different species [PMC7073773; PMC7191744].. It may regulate glycerophospholipid metabolism by inhibiting enzymes involved in triglyceride synthesis and degradation [PMC5341059]. Despite its emerging significance, further research is needed to fully understand bta-let-7c's role during bovine mastitis and other conditions affecting cattle health [PMC7937231].

Literature search
52 open access papers mention bta-let-7c
(234 sentences)

Sequence

243137 reads, 1249 reads per million, 76 experiments
gcauccggguUGAGGUAGUAGGUUGUAUGGUUuagaguuacacccugggaguuaacuguacaaccuucuagcuuuccuuggagc
((.((((((..(((.(((.(((((((((((((..((.(..((...))..).))))))))))))))).))).)))..))))))))

Structure
  a      uU   G   U             ua  g ua  c 
gc uccggg  GAG UAG AGGUUGUAUGGUU  ga u  ca  
|| ||||||  ||| ||| |||||||||||||  || |  || c
cg agguuc  uuc auc uccaacaugucaa  uu a  gu  
  -      cu   g   u             --  g gg  c 


Annotation confidence High
Do you think this miRNA is real?

Genome context
chr1: 19984844-19984927 [-]
Clustered miRNAs
1 other miRNA is < 10 kb from bta-let-7c
Name Accession Chromosome Start End Strand Confidence




Database links

Mature bta-let-7c

Accession MIMAT0004332
Description Bos taurus bta-let-7c mature miRNA
Sequence 11 - UGAGGUAGUAGGUUGUAUGGUU - 32
Evidence experimental
cloned [1]

References

  1. PubMed ID: 17306260
    Identification and characterization of microRNAs from the bovine adipose tissue and mammary gland
    "Gu Z, Eleswarapu S, Jiang H"
    "FEBS Lett (2007) 581:981-988