Stem-loop sequence bta-let-7e

Accession MI0005455
Description Bos taurus let-7e stem-loop
Gene family MIPF0000002; let-7
Community annotation

This text is a summary paragraph taken from the Wikipedia entry entitled let-7_microRNA_precursor. miRBase and Rfam are facilitating community annotation of microRNA families and entries in Wikipedia. Read more ...

The Let-7 microRNA precursor was identified from a study of developmental timing in C. elegans, and was later shown to be part of a much larger class of non-coding RNAs termed microRNAs. miR-98 microRNA precursor from human is a let-7 family member. Let-7 miRNAs have now been predicted or experimentally confirmed in a wide range of species (MIPF000002). miRNAs are initially transcribed in long transcripts (up to several hundred nucleotides) called primary miRNAs (pri-miRNAs), which are processed in the nucleus by Drosha and Pasha to hairpin structures of about ~70 nucleotide. These precursors (pre-miRNAs) are exported to the cytoplasm by exportin5, where they are subsequently processed by the enzyme Dicer to a ~22 nucleotide mature miRNA. The involvement of Dicer in miRNA processing demonstrates a relationship with the phenomenon of RNA interference.

Show Wikipedia entry View @ Wikipedia Edit Wikipedia entry
Stem-loop
  c   cu   g                u  ----gga  a 
cc ggg  gag uaggagguuguauagu ga       gg c
|| |||  ||| |||||||||||||||| ||       ||  
gg ccc  uuc auccuccggcauauca cu       cc a
  a   cu   g                -  agaggaa  c 
Get sequence
Genome context
Coordinates (UMD3.1) Overlapping transcripts
chr18: 58015036-58015114 [+]
sense
ENSBTAT00000031802 ; 3'UTR (exon 2)
Clustered miRNAs
< 10kb from bta-let-7e
bta-mir-99b chr18: 58014868-58014937 [+]
bta-let-7e chr18: 58015036-58015114 [+]
bta-mir-125a chr18: 58015535-58015620 [+]
Database links

Mature sequence bta-let-7e

Accession MIMAT0004333
Sequence

8 - 

ugagguaggagguuguauagu

 - 28

Get sequence
Evidence experimental; cloned [1]
Predicted targets

References

1