![]() |
miRBase |
![]() |
![]() |
Stem-loop sequence bta-mir-19b |
||||||||||||||
Accession | MI0005461 (change log) | |||||||||||||
Description | Bos taurus miR-19b stem-loop | |||||||||||||
Gene family | MIPF0000011; mir-19 | |||||||||||||
Literature search |
![]()
10 open access papers mention bta-mir-19b | |||||||||||||
Stem-loop |
uu - - uc ugugu 5' cacug cuaugguuaguuuugca gg uuugca cagc g ||||| ||||||||||||||||| || |||||| |||| a 3' gugau ggugucagucaaaacgu cc aaacgu gucg u -- a u -- ucuua |
|||||||||||||
Deep sequencing |
| |||||||||||||
Confidence |
Annotation confidence: high
| |||||||||||||
Genome context |
|
|||||||||||||
Clustered miRNAs |
|
|||||||||||||
Database links |
|
Mature sequence bta-miR-19b |
|
Accession | MIMAT0004337 |
Sequence |
54 - ugugcaaauccaugcaaaacuga - 76 |
Deep sequencing | 65402 reads, 76 experiments |
Evidence | experimental; cloned [2] |
Predicted targets |
|
References |
|
1 |
PMID:17306260
"Identification and characterization of microRNAs from the bovine adipose tissue and mammary gland"
FEBS Lett. 581:981-988(2007).
|
2 |
PMID:19267191
"Identification and characteristics of cattle microRNAs by homology searching and small RNA cloning"
Biochem Genet. 47:329-343(2009).
|