![]() |
miRBase |
![]() |
![]() |
Stem-loop sequence bta-mir-660 |
||||||||||||||
Accession | MI0005468 (change log) | |||||||||||||
Description | Bos taurus miR-660 stem-loop | |||||||||||||
Gene family | MIPF0000113; mir-188 | |||||||||||||
Literature search |
2 open access papers mention bta-mir-660 | |||||||||||||
Stem-loop |
cugcuccu c -c u c c gaau 5' ucucc gua ccau gcauau ggag ugu u ||||| ||| |||| |||||| |||| ||| c 3' ggagg cau ggua cgugua ccuc acg u -------g a ua - u c aaac |
|||||||||||||
Deep sequencing |
| |||||||||||||
Confidence |
Annotation confidence: not enough data
| |||||||||||||
Genome context |
|
|||||||||||||
Clustered miRNAs |
|
|||||||||||||
Database links |
|
Mature sequence bta-miR-660 |
|
Accession | MIMAT0004344 |
Sequence |
16 - uacccauugcauaucggagcug - 37 |
Deep sequencing | 100088 reads, 77 experiments |
Evidence | experimental; cloned [1] |
Predicted targets |
|
References |
|
1 |
PMID:17306260
"Identification and characterization of microRNAs from the bovine adipose tissue and mammary gland"
FEBS Lett. 581:981-988(2007).
|