Stem-loop sequence mmu-mir-876

Accession MI0005480
Symbol MGI:Mir876
Description Mus musculus miR-876 stem-loop
Gene family MIPF0000430; mir-876
Stem-loop 
ucac ug         u  c             au  aa 
    g  cuauggauu cu ugugaaucacuau  ca  u
    |  ||||||||| || |||||||||||||  ||  c
    c  gauacuuaa ga acauuuggugaug  gu  u
acuu gu         u  a             gu  ga
Get sequence
Deep sequencing
33 reads, 15 experiments
Genome context
Coordinates (GRCm38) Overlapping transcripts
chr4: 36645373-36645453 [-]
sense
OTTMUST00000014888 ; Lingo2-005; intron 2
OTTMUST00000014873 ; Lingo2-001; intron 2
ENSMUST00000124999 ; Lingo2-005; intron 2
ENSMUST00000108122 ; Lingo2-001; intron 2
Database links

Mature sequence mmu-miR-876-5p

Accession MIMAT0004854
Sequence

11 -  

uggauuucucugugaaucacua

 - 32

Get sequence
Deep sequencing 23 reads, 11 experiments
Evidence experimental; cloned [1], Solexa [2-3]
Predicted targets

Mature sequence mmu-miR-876-3p

Accession MIMAT0004855
Sequence

50 -  

uagugguuuacaaaguaauuca

 - 71

Get sequence
Deep sequencing 1 reads, 1 experiments
Evidence experimental; Solexa [2-3]
Predicted targets

References

1
PMID:17604727 "A mammalian microRNA expression atlas based on small RNA library sequencing" Landgraf P, Rusu M, Sheridan R, Sewer A, Iovino N, Aravin A, Pfeffer S, Rice A, Kamphorst AO, Landthaler M, Lin C, Socci ND, Hermida L, Fulci V, Chiaretti S, Foa R, Schliwka J, Fuchs U, Novosel A, Muller RU, Schermer B, Bissels U, Inman J, Phan Q, Chien M Cell. 129:1401-1414(2007).
2
PMID:20215419 "MicroRNA transcriptome in the newborn mouse ovaries determined by massive parallel sequencing" Ahn HW, Morin RD, Zhao H, Harris RA, Coarfa C, Chen ZJ, Milosavljevic A, Marra MA, Rajkovic A Mol Hum Reprod. 16:463-471(2010).
3
PMID:20413612 "Mammalian microRNAs: experimental evaluation of novel and previously annotated genes" Chiang HR, Schoenfeld LW, Ruby JG, Auyeung VC, Spies N, Baek D, Johnston WK, Russ C, Luo S, Babiarz JE, Blelloch R, Schroth GP, Nusbaum C, Bartel DP Genes Dev. 24:992-1009(2010).