Stem-loop sequence mmu-mir-18b

Accession MI0005483
Symbol MGI:Mir18b
Description Mus musculus miR-18b stem-loop
Gene family MIPF0000001; mir-17
Community annotation

This text is a summary paragraph taken from the Wikipedia entry entitled mir-17_microRNA_precursor_family. miRBase and Rfam are facilitating community annotation of microRNA families and entries in Wikipedia. Read more ...

The miR-17 microRNA precursor family are a group of related small non-coding RNA genes called microRNAs that regulate gene expression. The microRNA precursor miR-17 family, includes miR-20, miR-91, and miR-103. miRNAs are transcribed as ~70 nucleotide precursors and subsequently processed by the Dicer enzyme to give a ~22 nucleotide product. In this case the mature sequence comes from the 3' arm of the precursor. The products are thought to have regulatory roles through complementarity to the 3' UTR of mRNA. A screen of 17 miRNAs that have been predicted to regulate a number of breast cancer associated genes found variations in the microRNAs miR-17 and miR-30c-1, these patients were noncarriers of BRCA1 or BRCA2 mutations, lending the possibility that familial breast cancer may be caused by variation in these miRNAs..

Show Wikipedia entry View @ Wikipedia Edit Wikipedia entry
Stem-loop
ucu       --u    u    c   ugcuguuagugaagc 
   cuugugu   aagg gcau uag               a
   |||||||   |||| |||| |||               g
   ggacacg   uucc cgua auc               c
auc       cuc    c    a   ccgucaucuaacauu 
Get sequence
Deep sequencing
531944 reads, 94 experiments
Genome context
Coordinates (GRCm38) Overlapping transcripts
chrX: 52742331-52742413 [-]
intergenic
Clustered miRNAs
< 10kb from mmu-mir-18b
mmu-mir-106a chrX: 52742503-52742567 [-]
mmu-mir-18b chrX: 52742331-52742413 [-]
mmu-mir-20b chrX: 52742113-52742192 [-]
mmu-mir-19b-2 chrX: 52741983-52742066 [-]
mmu-mir-92a-2 chrX: 52741838-52741928 [-]
mmu-mir-363 chrX: 52741693-52741767 [-]
Database links

Mature sequence mmu-miR-18b-5p

Accession MIMAT0004858
Previous IDs mmu-miR-18b
Sequence

11 - 

uaaggugcaucuagugcuguuag

 - 33

Get sequence
Deep sequencing 67353 reads, 79 experiments
Evidence experimental; cloned [1], Solexa [2]
Predicted targets

Mature sequence mmu-miR-18b-3p

Accession MIMAT0017270
Previous IDs mmu-miR-18b*
Sequence

51 - 

uacugcccuaaaugccccuucu

 - 72

Get sequence
Deep sequencing 626 reads, 43 experiments
Evidence experimental; Solexa [2]
Predicted targets

References

1
PMID:17604727 "A mammalian microRNA expression atlas based on small RNA library sequencing" Landgraf P, Rusu M, Sheridan R, Sewer A, Iovino N, Aravin A, Pfeffer S, Rice A, Kamphorst AO, Landthaler M, Lin C, Socci ND, Hermida L, Fulci V, Chiaretti S, Foa R, Schliwka J, Fuchs U, Novosel A, Muller RU, Schermer B, Bissels U, Inman J, Phan Q, Chien M Cell. 129:1401-1414(2007).
2
PMID:20413612 "Mammalian microRNAs: experimental evaluation of novel and previously annotated genes" Chiang HR, Schoenfeld LW, Ruby JG, Auyeung VC, Spies N, Baek D, Johnston WK, Russ C, Luo S, Babiarz JE, Blelloch R, Schroth GP, Nusbaum C, Bartel DP Genes Dev. 24:992-1009(2010).