|
miRBase |
|
Mature sequence mmu-miR-466c-5p |
|
| Accession | MIMAT0004877 |
| Sequence |
11 - ugaugugugugugcauguacauau - 34 |
| Deep sequencing | 8730 reads, 71 experiments |
| Evidence | experimental; cloned [1], Solexa [2-3] |
| Predicted targets |
|
Mature sequence mmu-miR-466c-3p |
|
| Accession | MIMAT0004878 |
| Sequence |
52 - auacauacacgcacacauaaga - 73 |
| Deep sequencing | 12990 reads, 77 experiments |
| Evidence | experimental; cloned [1], Solexa [2-3] |
| Predicted targets |
|
References |
|
| 1 |
PMID:17604727
"A mammalian microRNA expression atlas based on small RNA library sequencing"
Cell. 129:1401-1414(2007).
|
| 2 |
PMID:20215419
"MicroRNA transcriptome in the newborn mouse ovaries determined by massive parallel sequencing"
Mol Hum Reprod. 16:463-471(2010).
|
| 3 |
PMID:20413612
"Mammalian microRNAs: experimental evaluation of novel and previously annotated genes"
Genes Dev. 24:992-1009(2010).
|