![]() |
miRBase |
![]() |
![]() |
Stem-loop sequence mmu-mir-466f-1 |
||||||||||||||||||||||||||||||||||||||||
Accession | MI0005507 (change log) | |||||||||||||||||||||||||||||||||||||||
Symbol | MGI:Mir466f-1 | |||||||||||||||||||||||||||||||||||||||
Description | Mus musculus miR-466f-1 stem-loop | |||||||||||||||||||||||||||||||||||||||
Gene family | MIPF0000316; mir-467 | |||||||||||||||||||||||||||||||||||||||
Literature search |
![]()
28 open access papers mention mmu-mir-466f-1 | |||||||||||||||||||||||||||||||||||||||
Stem-loop |
-------------- u c c c au 5' caugugugu ua gugugugug augug augugugu a ||||||||| || ||||||||| ||||| |||||||| 3' guacacaca au cacacacac uacac uacauaua u uauacacacacaac c a a a ag |
|||||||||||||||||||||||||||||||||||||||
Deep sequencing |
| |||||||||||||||||||||||||||||||||||||||
Confidence |
Annotation confidence: not enough data
| |||||||||||||||||||||||||||||||||||||||
Comments |
Landgraf et al. identify several offset sequences which map to the 3' arm of the miR-466f hairpin precursors [1]. One sequence consistent with all three putative hairpin loci is shown here. |
|||||||||||||||||||||||||||||||||||||||
Genome context |
|
|||||||||||||||||||||||||||||||||||||||
Clustered miRNAs |
|
|||||||||||||||||||||||||||||||||||||||
Database links |
|
Mature sequence mmu-miR-466f-5p |
|
Accession | MIMAT0004881 |
Sequence |
11 - uacgugugugugcaugugcaug - 32 |
Deep sequencing | 8511 reads, 90 experiments |
Evidence | experimental; cloned [1], Illumina [2] |
Database links |
|
Predicted targets |
|
Mature sequence mmu-miR-466f-3p |
|
Accession | MIMAT0004882 |
Sequence |
55 - cauacacacacacauacacac - 75 |
Deep sequencing | 56401 reads, 165 experiments |
Evidence | experimental; cloned [1], Illumina [2] |
Database links |
|
Predicted targets |
|
References |
|
1 |
PMID:17604727
"A mammalian microRNA expression atlas based on small RNA library sequencing"
Cell. 129:1401-1414(2007).
|
2 |
PMID:20413612
"Mammalian microRNAs: experimental evaluation of novel and previously annotated genes"
Genes Dev. 24:992-1009(2010).
|