![]() |
miRBase |
![]() |
![]() |
Stem-loop sequence mmu-mir-466f-3 |
||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Accession | MI0005509 (change log) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||
Symbol | MGI:Mir466f-3 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||
Description | Mus musculus miR-466f-3 stem-loop | |||||||||||||||||||||||||||||||||||||||||||||||||||||||
Gene family | MIPF0000316; mir-467 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||
Literature search |
![]()
28 open access papers mention mmu-mir-466f-3 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||
Stem-loop |
---ca ua c --ca gaa 5' uguguguu cgugugugug augug uguguguauau u |||||||| |||||||||| ||||| ||||||||||| 3' acacacaa gcacgcacac uacac acauacauaug a cacac -c a acac uau |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||
Deep sequencing |
| |||||||||||||||||||||||||||||||||||||||||||||||||||||||
Confidence |
Annotation confidence: not enough data
| |||||||||||||||||||||||||||||||||||||||||||||||||||||||
Comments |
Landgraf et al. identify several offset sequences which map to the 3' arm of the miR-466f hairpin precursors [1]. One sequence consistent with all three putative hairpin loci is shown here. |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||
Genome context |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||
Clustered miRNAs |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||
Database links |
|
Mature sequence mmu-miR-466f-5p |
|
Accession | MIMAT0004881 |
Sequence |
11 - uacgugugugugcaugugcaug - 32 |
Deep sequencing | 8511 reads, 90 experiments |
Evidence | experimental; cloned [1], Illumina [2] |
Database links |
|
Predicted targets |
|
Mature sequence mmu-miR-466f-3p |
|
Accession | MIMAT0004882 |
Sequence |
55 - cauacacacacacauacacac - 75 |
Deep sequencing | 56401 reads, 165 experiments |
Evidence | experimental; cloned [1], Illumina [2] |
Database links |
|
Predicted targets |
|
References |
|
1 |
PMID:17604727
"A mammalian microRNA expression atlas based on small RNA library sequencing"
Cell. 129:1401-1414(2007).
|
2 |
PMID:20413612
"Mammalian microRNAs: experimental evaluation of novel and previously annotated genes"
Genes Dev. 24:992-1009(2010).
|