miRBase entry: mmu-mir-878

Stem-loop mmu-mir-878


Accession
MI0005548
Symbol
MGI: Mir878
Description
Mus musculus mmu-mir-878 precursor miRNA
Gene family
MIPF0000434; mir-878

Literature search
3 open access papers mention mmu-mir-878
(4 sentences)

Sequence

96065 reads, 2729 reads per million, 42 experiments
ugcaaugcuuUAUCUAGUUGGAUGUCAAGACAcgugaaacuuaaguGCAUGACACCACACUGGGUAGAggagggcuca
.((..(.((((((((((((((.(((((.(.(((...........)))).)))))))).))))))))))).)..))...

Structure
--u  aa g           -   A     A A   guga 
   gc  u cuuUAUCUAGU UGG UGUCA G CAc    a
   ||  | ||||||||||| ||| ||||| | |||    a
   cg  a gAGAUGGGUCA ACC ACAGU C Gug    c
acu  gg g           C   -     A -   aauu 


Annotation confidence High
Do you think this miRNA is real?
Comments
This sequence was identified as a miRNA candidate by Berezikov et al. using RAKE and MPSS techniques [1]. Expression was later confirmed by cloning [2].

Genome context
chrX: 66801508-66801585 [-]
Clustered miRNAs
6 other miRNAs are < 10 kb from mmu-mir-878
Name Accession Chromosome Start End Strand Confidence




Database links

Mature mmu-miR-878-5p

Accession MIMAT0004932
Description Mus musculus mmu-miR-878-5p mature miRNA
Sequence 11 - UAUCUAGUUGGAUGUCAAGACA - 32
Evidence experimental
cloned [2], 454 [3], Illumina [4-5]
Database links
Predicted targets

Mature mmu-miR-878-3p

Accession MIMAT0004933
Description Mus musculus mmu-miR-878-3p mature miRNA
Sequence 47 - GCAUGACACCACACUGGGUAGA - 68
Evidence experimental
cloned [2], Illumina [4-5]
Database links
Predicted targets

References

  1. PubMed ID: 17604727
    A mammalian microRNA expression atlas based on small RNA library sequencing
    "Landgraf P, Rusu M, Sheridan R, Sewer A, Iovino N, Aravin A, Pfeffer S, Rice A, Kamphorst AO, Landthaler M, Lin C, Socci ND, Hermida L, Fulci V, Chiaretti S, Foa R, Schliwka J, Fuchs U, Novosel A, Muller RU, Schermer B, Bissels U, Inman J, Phan Q, Chien M"
    "Cell (2007) 129:1401-1414

  2. PubMed ID: 20215419
    MicroRNA transcriptome in the newborn mouse ovaries determined by massive parallel sequencing
    "Ahn HW, Morin RD, Zhao H, Harris RA, Coarfa C, Chen ZJ, Milosavljevic A, Marra MA, Rajkovic A"
    "Mol Hum Reprod (2010) 16:463-471

  3. PubMed ID: 20413612
    Mammalian microRNAs: experimental evaluation of novel and previously annotated genes
    "Chiang HR, Schoenfeld LW, Ruby JG, Auyeung VC, Spies N, Baek D, Johnston WK, Russ C, Luo S, Babiarz JE, Blelloch R, Schroth GP, Nusbaum C, Bartel DP"
    "Genes Dev (2010) 24:992-1009

  4. PubMed ID: 16954537
    Many novel mammalian microRNA candidates identified by extensive cloning and RAKE analysis
    "Berezikov E, van Tetering G, Verheul M, van de Belt J, van Laake L, Vos J, Verloop R, van de Wetering M, Guryev V, Takada S, van Zonneveld AJ, Mano H, Plasterk R, Cuppen E"
    "Genome Res (2006) 16:1289-1298

  5. PubMed ID: 17989215
    RNA sequence analysis defines Dicer's role in mouse embryonic stem cells
    "Calabrese JM, Seila AC, Yeo GW, Sharp PA"
    "Proc Natl Acad Sci U S A (2007) 104:18097-18102