|
miRBase |
|
Stem-loop sequence mmu-mir-878 |
|||||
| Accession | MI0005548 | ||||
| Symbol | MGI:Mir878 | ||||
| Description | Mus musculus miR-878 stem-loop | ||||
| Gene family | MIPF0000434; mir-878 | ||||
| Stem-loop |
--u aa g - a a a guga gc u cuuuaucuagu ugg uguca g cac a || | ||||||||||| ||| ||||| | ||| a cg a gagauggguca acc acagu c gug c acu gg g c - a - aauu |
||||
| Deep sequencing |
| ||||
| Comments |
This sequence was identified as a miRNA candidate by Berezikov et al. using RAKE and MPSS techniques [1]. Expression was later confirmed by cloning [2]. |
||||
| Genome context |
|
||||
| Clustered miRNAs | |||||
| Database links | |||||
Mature sequence mmu-miR-878-5p |
|
| Accession | MIMAT0004932 |
| Sequence |
11 - uaucuaguuggaugucaagaca - 32 |
| Evidence | experimental; cloned [2], 454 [3], Solexa [4-5] |
| Predicted targets |
|
Mature sequence mmu-miR-878-3p |
|
| Accession | MIMAT0004933 |
| Sequence |
47 - gcaugacaccacacuggguaga - 68 |
| Evidence | experimental; cloned [2], Solexa [4-5] |
| Predicted targets |
|
References |
|
| 1 |
PMID:16954537
"Many novel mammalian microRNA candidates identified by extensive cloning and RAKE analysis"
Genome Res. 16:1289-1298(2006).
|
| 2 |
PMID:17604727
"A mammalian microRNA expression atlas based on small RNA library sequencing"
Cell. 129:1401-1414(2007).
|
| 3 |
PMID:17989215
"RNA sequence analysis defines Dicer's role in mouse embryonic stem cells"
Proc Natl Acad Sci U S A. 104:18097-18102(2007).
|
| 4 |
PMID:20215419
"MicroRNA transcriptome in the newborn mouse ovaries determined by massive parallel sequencing"
Mol Hum Reprod. 16:463-471(2010).
|
| 5 |
PMID:20413612
"Mammalian microRNAs: experimental evaluation of novel and previously annotated genes"
Genes Dev. 24:992-1009(2010).
|