miRBase entry: mmu-mir-872

Stem-loop mmu-mir-872


Accession
MI0005549
Symbol
MGI: Mir872
Description
Mus musculus mmu-mir-872 precursor miRNA
Gene family
MIPF0000399; mir-872

Literature search
4 open access papers mention mmu-mir-872
(13 sentences)

Sequence

203265 reads, 845 reads per million, 104 experiments
aacuuguuagAAGGUUACUUGUUAGUUCAGGaccucauuacuuucugccUGAACUAUUGCAGUAGCCUCCUaacugguuau
((((.(((((.((((((((.(((((((((((................)))))))))..)))))))))).))))).))))..

Structure
--    u     A        U  --         accucau 
  aacu guuag AGGUUACU GU  UAGUUCAGG       u
  |||| ||||| |||||||| ||  |||||||||        
  uugg caaUC UCCGAUGA CG  AUCAAGUcc       a
ua    u     C        -  UU         gucuuuc 


Annotation confidence High
Do you think this miRNA is real?
Comments
This sequence was identified as a miRNA candidate by Berezikov et al. using RAKE and MPSS techniques [1]. Expression was later confirmed by cloning [2].

Genome context
chr4: 94665157-94665237 [+]

Database links

Mature mmu-miR-872-5p

Accession MIMAT0004934
Description Mus musculus mmu-miR-872-5p mature miRNA
Sequence 11 - AAGGUUACUUGUUAGUUCAGG - 31
Evidence experimental
cloned [2], Illumina [3-4]
Database links
Predicted targets

Mature mmu-miR-872-3p

Accession MIMAT0004935
Description Mus musculus mmu-miR-872-3p mature miRNA
Sequence 50 - UGAACUAUUGCAGUAGCCUCCU - 71
Evidence experimental
cloned [2], Illumina [3-4]
Database links
Predicted targets

References

  1. PubMed ID: 17604727
    A mammalian microRNA expression atlas based on small RNA library sequencing
    "Landgraf P, Rusu M, Sheridan R, Sewer A, Iovino N, Aravin A, Pfeffer S, Rice A, Kamphorst AO, Landthaler M, Lin C, Socci ND, Hermida L, Fulci V, Chiaretti S, Foa R, Schliwka J, Fuchs U, Novosel A, Muller RU, Schermer B, Bissels U, Inman J, Phan Q, Chien M"
    "Cell (2007) 129:1401-1414

  2. PubMed ID: 20215419
    MicroRNA transcriptome in the newborn mouse ovaries determined by massive parallel sequencing
    "Ahn HW, Morin RD, Zhao H, Harris RA, Coarfa C, Chen ZJ, Milosavljevic A, Marra MA, Rajkovic A"
    "Mol Hum Reprod (2010) 16:463-471

  3. PubMed ID: 20413612
    Mammalian microRNAs: experimental evaluation of novel and previously annotated genes
    "Chiang HR, Schoenfeld LW, Ruby JG, Auyeung VC, Spies N, Baek D, Johnston WK, Russ C, Luo S, Babiarz JE, Blelloch R, Schroth GP, Nusbaum C, Bartel DP"
    "Genes Dev (2010) 24:992-1009

  4. PubMed ID: 16954537
    Many novel mammalian microRNA candidates identified by extensive cloning and RAKE analysis
    "Berezikov E, van Tetering G, Verheul M, van de Belt J, van Laake L, Vos J, Verloop R, van de Wetering M, Guryev V, Takada S, van Zonneveld AJ, Mano H, Plasterk R, Cuppen E"
    "Genome Res (2006) 16:1289-1298