|
miRBase |
|
Stem-loop sequence mmu-mir-875 |
||||||
| Accession | MI0005551 | |||||
| Symbol | MGI:Mir875 | |||||
| Description | Mus musculus miR-875 stem-loop | |||||
| Gene family | MIPF0000424; mir-875 | |||||
| Stem-loop |
--- u u u - u a uuca uc gugg ac aua ccucagu uu ucaggug u || |||| || ||| ||||||| || ||||||| u ag cacu ug uau ggaguca aa aguccac a acg u u - c u a uaaa |
|||||
| Deep sequencing |
| |||||
| Comments |
This sequence was identified as a miRNA candidate by Berezikov et al. using RAKE and MPSS techniques [1]. Expression was independently shown in human and rat [2]. |
|||||
| Genome context |
|
|||||
| Clustered miRNAs |
|
|||||
| Database links | ||||||
Mature sequence mmu-miR-875-5p |
|
| Accession | MIMAT0004937 |
| Sequence |
11 - uauaccucaguuuuaucaggug - 32 |
| Deep sequencing | 214 reads, 21 experiments |
| Evidence | experimental; RAKE [1], Solexa [3] |
| Predicted targets |
|
Mature sequence mmu-miR-875-3p |
|
| Accession | MIMAT0004938 |
| Sequence |
46 - ccugaaaauacugaggcuaug - 66 |
| Deep sequencing | 66 reads, 3 experiments |
| Evidence | experimental; RAKE [1], Solexa [3] |
| Predicted targets |
|
References |
|
| 1 |
PMID:16954537
"Many novel mammalian microRNA candidates identified by extensive cloning and RAKE analysis"
Genome Res. 16:1289-1298(2006).
|
| 2 |
PMID:17604727
"A mammalian microRNA expression atlas based on small RNA library sequencing"
Cell. 129:1401-1414(2007).
|
| 3 |
PMID:20413612
"Mammalian microRNAs: experimental evaluation of novel and previously annotated genes"
Genes Dev. 24:992-1009(2010).
|