miRBase entry: mmu-mir-511

Stem-loop mmu-mir-511


Accession
MI0005554
Symbol
MGI: Mir511
Description
Mus musculus mmu-mir-511 precursor miRNA

Literature search
10 open access papers mention mmu-mir-511
(141 sentences)

Sequence

6262 reads, 53 reads per million, 81 experiments
gauacccaccAUGCCUUUUGCUCUGCACUCAguaaauaauaauuugugAAUGUGUAGCAAAAGACAGGAUggggaucca
((..((((((.((.((((((((.((((.(((.(((((....)))))))).)))).)))))))).)))).))))..))..

Structure
--  ua    -  A  C        C    C   g     a 
  ga  ccca cc UG CUUUUGCU UGCA UCA uaaau a
  ||  |||| || || |||||||| |||| ||| |||||  
  cu  gggU GG AC GAAAACGA GUGU Agu guuua u
ac  ag    A  -  A        U    A   -     a 


Annotation confidence Medium
Do you think this miRNA is real?
Comments
This sequence was identified as a miRNA candidate by Berezikov et al. using RAKE and MPSS techniques [1]. Expression was independently shown in human and rat [2].

Genome context
chr2: 14261003-14261081 [+]

Database links

Mature mmu-miR-511-5p

Accession MIMAT0004940
Description Mus musculus mmu-miR-511-5p mature miRNA
Sequence 11 - AUGCCUUUUGCUCUGCACUCA - 31
Evidence experimental
RAKE [1], Illumina [3-4]
Database links
Predicted targets

Mature mmu-miR-511-3p

Accession MIMAT0017281
Description Mus musculus mmu-miR-511-3p mature miRNA
Sequence 49 - AAUGUGUAGCAAAAGACAGGAU - 70
Evidence experimental
Illumina [4]
Database links
Predicted targets

References

  1. PubMed ID: 17604727
    A mammalian microRNA expression atlas based on small RNA library sequencing
    "Landgraf P, Rusu M, Sheridan R, Sewer A, Iovino N, Aravin A, Pfeffer S, Rice A, Kamphorst AO, Landthaler M, Lin C, Socci ND, Hermida L, Fulci V, Chiaretti S, Foa R, Schliwka J, Fuchs U, Novosel A, Muller RU, Schermer B, Bissels U, Inman J, Phan Q, Chien M"
    "Cell (2007) 129:1401-1414

  2. PubMed ID: 20215419
    MicroRNA transcriptome in the newborn mouse ovaries determined by massive parallel sequencing
    "Ahn HW, Morin RD, Zhao H, Harris RA, Coarfa C, Chen ZJ, Milosavljevic A, Marra MA, Rajkovic A"
    "Mol Hum Reprod (2010) 16:463-471

  3. PubMed ID: 20413612
    Mammalian microRNAs: experimental evaluation of novel and previously annotated genes
    "Chiang HR, Schoenfeld LW, Ruby JG, Auyeung VC, Spies N, Baek D, Johnston WK, Russ C, Luo S, Babiarz JE, Blelloch R, Schroth GP, Nusbaum C, Bartel DP"
    "Genes Dev (2010) 24:992-1009

  4. PubMed ID: 16954537
    Many novel mammalian microRNA candidates identified by extensive cloning and RAKE analysis
    "Berezikov E, van Tetering G, Verheul M, van de Belt J, van Laake L, Vos J, Verloop R, van de Wetering M, Guryev V, Takada S, van Zonneveld AJ, Mano H, Plasterk R, Cuppen E"
    "Genome Res (2006) 16:1289-1298