|
miRBase |
|
Mature sequence mmu-miR-544-5p |
|
| Accession | MIMAT0017282 |
| Sequence |
11 - ucuuguuaaaaagcagagucu - 31 |
| Deep sequencing | 2120 reads, 26 experiments |
| Evidence | experimental; Solexa [4] |
| Predicted targets |
|
Mature sequence mmu-miR-544-3p |
|
| Accession | MIMAT0004941 |
| Previous IDs | mmu-miR-544 |
| Sequence |
47 - auucugcauuuuuagcaagcuc - 68 |
| Deep sequencing | 321 reads, 26 experiments |
| Evidence | experimental; RAKE [1], Solexa [3-4] |
| Predicted targets |
|
References |
|
| 1 |
PMID:16954537
"Many novel mammalian microRNA candidates identified by extensive cloning and RAKE analysis"
Genome Res. 16:1289-1298(2006).
|
| 2 |
PMID:17604727
"A mammalian microRNA expression atlas based on small RNA library sequencing"
Cell. 129:1401-1414(2007).
|
| 3 |
PMID:20215419
"MicroRNA transcriptome in the newborn mouse ovaries determined by massive parallel sequencing"
Mol Hum Reprod. 16:463-471(2010).
|
| 4 |
PMID:20413612
"Mammalian microRNAs: experimental evaluation of novel and previously annotated genes"
Genes Dev. 24:992-1009(2010).
|