![]() |
miRBase |
![]() |
![]() |
Stem-loop sequence hsa-mir-887 |
|||||
Accession | MI0005562 (change log) | ||||
Symbol | HGNC:MIR887 | ||||
Description | Homo sapiens miR-887 stem-loop | ||||
Gene family | MIPF0000554; mir-887 | ||||
Literature search |
![]()
12 open access papers mention hsa-mir-887 | ||||
Stem-loop |
-- u -- - ag ug auu 5' gugcaga ccuuggga gc ccuguu acuc g u ||||||| |||||||| || |||||| |||| | u 3' cacguuu ggagcccu cg gggcaa ugag u a ga c ac c -g gu cac |
||||
Deep sequencing |
| ||||
Confidence |
Annotation confidence: high
| ||||
Comments |
This sequence was identified as a miRNA candidate by Berezikov et al. using RAKE and MPSS techniques [1]. Expression was later confirmed by cloning [2]. |
||||
Genome context |
|
||||
Database links |
|
Mature sequence hsa-miR-887-5p |
|
Accession | MIMAT0026720 |
Sequence |
10 - cuugggagcccuguuagacuc - 30 |
Deep sequencing | 657 reads, 93 experiments |
Evidence | experimental; Illumina [3] |
Database links |
|
Predicted targets |
|
Mature sequence hsa-miR-887-3p |
|
Accession | MIMAT0004951 |
Sequence |
48 - gugaacgggcgccaucccgagg - 69 |
Deep sequencing | 17804 reads, 132 experiments |
Evidence | experimental; cloned [2], Illumina [3] |
Database links |
|
Predicted targets |
|
References |
|
1 |
PMID:16954537
"Many novel mammalian microRNA candidates identified by extensive cloning and RAKE analysis"
Genome Res. 16:1289-1298(2006).
|
2 |
PMID:17604727
"A mammalian microRNA expression atlas based on small RNA library sequencing"
Cell. 129:1401-1414(2007).
|
3 |
PMID:23034410
"Birth and expression evolution of mammalian microRNA genes"
Genome Res. 23:34-45(2013).
|