![]() |
miRBase |
![]() |
![]() |
Stem-loop sequence hsa-mir-216b |
|||||
Accession | MI0005569 (change log) | ||||
Symbol | HGNC:MIR216B | ||||
Description | Homo sapiens miR-216b stem-loop | ||||
Gene family | MIPF0000054; mir-216 | ||||
Literature search |
![]()
57 open access papers mention hsa-mir-216b | ||||
Stem-loop |
--g gaa a --caaa g ac 5' cagacug aaucucugc gg ugugau uc u ||||||| ||||||||| || |||||| || 3' gucugac uuagagaug cc acacua ag g aca auc c auucac a ga |
||||
Deep sequencing |
| ||||
Confidence |
Annotation confidence: not enough data
| ||||
Comments |
This sequence was identified as a miRNA candidate by Berezikov et al. using RAKE and MPSS techniques [1]. Expression was later confirmed by cloning [2]. |
||||
Genome context |
|
||||
Database links |
|
Mature sequence hsa-miR-216b-5p |
|
Accession | MIMAT0004959 |
Sequence |
11 - aaaucucugcaggcaaauguga - 32 |
Deep sequencing | 779 reads, 76 experiments |
Evidence | experimental; cloned [2], Illumina [3] |
Database links |
|
Predicted targets |
|
Mature sequence hsa-miR-216b-3p |
|
Accession | MIMAT0026721 |
Sequence |
49 - acacacuuacccguagagauucua - 72 |
Deep sequencing | 12 reads, 10 experiments |
Evidence | experimental; Illumina [3] |
Predicted targets |
|
References |
|
1 |
PMID:16954537
"Many novel mammalian microRNA candidates identified by extensive cloning and RAKE analysis"
Genome Res. 16:1289-1298(2006).
|
2 |
PMID:17604727
"A mammalian microRNA expression atlas based on small RNA library sequencing"
Cell. 129:1401-1414(2007).
|
3 |
PMID:23034410
"Birth and expression evolution of mammalian microRNA genes"
Genome Res. 23:34-45(2013).
|