Stem-loop sequence mtr-MIR156b

AccessionMI0005571 (change log)
DescriptionMedicago truncatula miR156b stem-loop
Gene family MIPF0000008; MIR156
Literature search

10 open access papers mention mtr-MIR156b
(77 sentences)

Stem-loop
   --  a         -                    acu    u u    u 
5'   gg ggugacaga agagagugagcacacauggu   uucg g auga g
     || ||||||||| ||||||||||||||||||||   |||| | ||||  
3'   cc ccacugucu ucucucacucguguguaucg   aagc c uacu u
   ua  -         a                    ---    u u    u 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (JCVI_Mt3.5.2) Overlapping transcripts
chr1: 4445878-4445972 [-]
intergenic
Database links

Mature sequence mtr-miR156b-5p

Accession MIMAT0011057
Sequence

6 - 

ugacagaagagagugagcac

 - 25

Get sequence
Evidence experimental; Illumina [2]

Mature sequence mtr-miR156b-3p

Accession MIMAT0026723
Sequence

70 - 

ugcucacucucuaucugucacc

 - 91

Get sequence
Evidence experimental; Illumina [2]

References

1
" Bonnet E Unpublished (2007).
2
PMID:23572382 "microRNA profiling of root tissues and root forming explant cultures in Medicago truncatula" Eyles RP, Williams PH, Ohms SJ, Weiller GF, Ogilvie HA, Djordjevic MA, Imin N Planta. 238:91-105(2013).