Stem-loop sequence mtr-MIR171b

AccessionMI0005580 (change log)
DescriptionMedicago truncatula miR171b stem-loop
Gene family MIPF0000030; MIR171_1
Literature search

8 open access papers mention mtr-MIR171b
(53 sentences)

Stem-loop
                    c       ugaa         -   aaaa 
5' agcaagguauuggcgcg cucaauu    uacauggcu aua    u
   ||||||||||||||||| |||||||    ||||||||| |||    g
3' uuguucuauaacugcgc gaguuag    auguaccga uau    c
                    c       uuug         c   acua 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (JCVI_Mt3.5.2) Overlapping transcripts
chr2: 27393335-27393428 [+]
intergenic
Database links

Mature sequence mtr-miR171b

Accession MIMAT0011066
Sequence

69 - 

ugauugagccgcgucaauauc

 - 89

Get sequence
Evidence experimental; 454 [2], Northern [2]

References

1
" Bonnet E Unpublished (2007).
2
PMID:19555436 "Cloning and characterization of small RNAs from Medicago truncatula reveals four novel legume-specific microRNA families" Jagadeeswaran G, Zheng Y, Li YF, Shukla LI, Matts J, Hoyt P, Macmil SL, Wiley GB, Roe BA, Zhang W, Sunkar R New Phytol. 184:85-98(2009).