Stem-loop sequence mtr-MIR156c

AccessionMI0005584 (change log)
DescriptionMedicago truncatula miR156c stem-loop
Gene family MIPF0000008; MIR156
Literature search

10 open access papers mention mtr-MIR156c
(77 sentences)

Stem-loop
   --  u         -              c     guu   uu   c  uu 
5'   gg ggugacaga agagagugagcaca auggu   uuc  gca ga  a
     || ||||||||| |||||||||||||| |||||   |||  ||| ||  u
3'   cc ccacugucu ucucucauucgugu uaucg   aag  cgu cu  g
   ca  -         a              a     ---   uu   c  uu 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (JCVI_Mt3.5.2) Overlapping transcripts
chr3: 36762577-36762674 [+]
intergenic
Database links

Mature sequence mtr-miR156c-5p

Accession MIMAT0011070
Sequence

6 - 

ugacagaagagagugagcac

 - 25

Get sequence
Evidence experimental; Illumina [2]

Mature sequence mtr-miR156c-3p

Accession MIMAT0026724
Sequence

73 - 

ugcuuacucucuaucugucacc

 - 94

Get sequence
Evidence experimental; Illumina [2]

References

1
" Bonnet E Unpublished (2007).
2
PMID:23572382 "microRNA profiling of root tissues and root forming explant cultures in Medicago truncatula" Eyles RP, Williams PH, Ohms SJ, Weiller GF, Ogilvie HA, Djordjevic MA, Imin N Planta. 238:91-105(2013).