Stem-loop sequence mtr-MIR156d

AccessionMI0005585 (change log)
DescriptionMedicago truncatula miR156d stem-loop
Gene family MIPF0000008; MIR156
Literature search

10 open access papers mention mtr-MIR156d
(77 sentences)

Stem-loop
   -   a         -  -          a    ca -u       g 
5'  gaa uugacagaa ga gagugagcac uaga  c  cgguaua a
    ||| ||||||||| || |||||||||| ||||  |  |||||||  
3'  cuu aacugucuu cu cucacucgug guuu  g  gcuauau u
   c   a         u  a          c    cc uu       g 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (JCVI_Mt3.5.2) Overlapping transcripts
chr3: 37487558-37487647 [-]
intergenic
Database links

Mature sequence mtr-miR156d-5p

Accession MIMAT0011071
Sequence

6 - 

ugacagaagagagugagcac

 - 25

Get sequence
Evidence experimental; Illumina [2]

Mature sequence mtr-miR156d-3p

Accession MIMAT0026725
Sequence

64 - 

ugcucacucaucuuucugucaaa

 - 86

Get sequence
Evidence experimental; Illumina [2]

References

1
" Bonnet E Unpublished (2007).
2
PMID:23572382 "microRNA profiling of root tissues and root forming explant cultures in Medicago truncatula" Eyles RP, Williams PH, Ohms SJ, Weiller GF, Ogilvie HA, Djordjevic MA, Imin N Planta. 238:91-105(2013).