Stem-loop sequence mtr-MIR390

AccessionMI0005586 (change log)
DescriptionMedicago truncatula miR390 stem-loop
Gene family MIPF0000101; MIR390
Literature search

3 open access papers mention mtr-MIR390
(12 sentences)

Stem-loop
       u          g         cau    u   -u  -uuuuuu  g 
5' cugu aagcucagga ggauagcgc   agaa guc  uc       ug u
   |||| |||||||||| |||||||||   |||| |||  ||       ||  
3' ggua uuugaguccu ccuaucgcg   ucuu uag  ag       ac u
       c          a         uuc    c   uu  uuauuuu  c 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (JCVI_Mt3.5.2) Overlapping transcripts
chr4: 3183409-3183508 [-]
intergenic
Database links

Mature sequence mtr-miR390

Accession MIMAT0011072
Sequence

6 - 

aagcucaggagggauagcgcc

 - 26

Get sequence
Evidence experimental; 454 [2], Northern [2]

References

1
" Bonnet E Unpublished (2007).
2
PMID:19555436 "Cloning and characterization of small RNAs from Medicago truncatula reveals four novel legume-specific microRNA families" Jagadeeswaran G, Zheng Y, Li YF, Shukla LI, Matts J, Hoyt P, Macmil SL, Wiley GB, Roe BA, Zhang W, Sunkar R New Phytol. 184:85-98(2009).